Incidental Mutation 'R5804:Zbtb22'
ID448427
Institutional Source Beutler Lab
Gene Symbol Zbtb22
Ensembl Gene ENSMUSG00000051390
Gene Namezinc finger and BTB domain containing 22
Synonyms1110008J20Rik, Bing1, Zfp297
MMRRC Submission 043211-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R5804 (G1)
Quality Score217
Status Not validated
Chromosome17
Chromosomal Location33915904-33919324 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGGACCCGGGAC to TGGACCCGGGACCCGGGAC at 33918619 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000053429] [ENSMUST00000079421] [ENSMUST00000170075] [ENSMUST00000172619] [ENSMUST00000174146] [ENSMUST00000174463] [ENSMUST00000174541]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000053429
SMART Domains Protein: ENSMUSP00000057466
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
BTB 57 151 7.21e-22 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 317 355 N/A INTRINSIC
low complexity region 390 403 N/A INTRINSIC
low complexity region 431 443 N/A INTRINSIC
low complexity region 460 479 N/A INTRINSIC
ZnF_C2H2 483 504 1.24e2 SMART
ZnF_C2H2 510 532 1.28e-3 SMART
ZnF_C2H2 538 559 4.69e0 SMART
low complexity region 567 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079421
SMART Domains Protein: ENSMUSP00000078390
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Daxx 54 152 1.3e-51 PFAM
Blast:KISc 185 261 2e-17 BLAST
PDB:4H9S|F 189 404 1e-131 PDB
SCOP:d1sig__ 437 493 7e-3 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 693 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170075
SMART Domains Protein: ENSMUSP00000128504
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172489
SMART Domains Protein: ENSMUSP00000133332
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
IG 18 142 3.45e0 SMART
SCOP:d2fbjh2 143 189 2e-3 SMART
Blast:IG_like 152 206 6e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172619
SMART Domains Protein: ENSMUSP00000134695
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
PDB:3F8U|D 12 119 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173279
Predicted Effect probably benign
Transcript: ENSMUST00000174146
SMART Domains Protein: ENSMUSP00000134158
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174463
SMART Domains Protein: ENSMUSP00000133345
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Pfam:BTB 47 87 7.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174541
SMART Domains Protein: ENSMUSP00000133552
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 702 1.5e-297 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189156
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A G 11: 101,990,814 N112S probably damaging Het
Abat A T 16: 8,578,236 R19* probably null Het
Abcb9 A G 5: 124,080,055 M406T probably benign Het
Ager A G 17: 34,598,183 E32G probably damaging Het
Cdk10 T A 8: 123,228,840 probably null Het
Ctsl A T 13: 64,366,488 Y259N probably damaging Het
Ctu2 T C 8: 122,481,226 probably null Het
Dse T A 10: 34,153,379 I572F possibly damaging Het
Flt1 A T 5: 147,580,437 probably null Het
Gatm T A 2: 122,602,602 Y193F probably benign Het
Gpaa1 T C 15: 76,332,626 F170S probably damaging Het
Grm3 A G 5: 9,570,155 L363P probably benign Het
Heatr5b G A 17: 78,831,522 P64S probably damaging Het
Hfm1 A G 5: 106,878,589 probably null Het
Hivep2 A C 10: 14,133,775 K1725N probably benign Het
Hmcn1 A T 1: 150,674,347 C2695* probably null Het
Hmgcr G A 13: 96,666,187 T68M probably damaging Het
Igsf21 A T 4: 140,028,074 D423E possibly damaging Het
Jag1 T C 2: 137,088,204 N751S probably benign Het
Klrc2 A T 6: 129,660,473 N28K possibly damaging Het
Lrrc8c A T 5: 105,579,557 D29V possibly damaging Het
Mtcl1 A C 17: 66,343,137 S1329A probably benign Het
Nin C T 12: 70,045,601 V645I possibly damaging Het
Olfr1006 T A 2: 85,674,338 D271V probably damaging Het
Olfr1262 T C 2: 90,002,988 I194T possibly damaging Het
Olfr283 T A 15: 98,378,334 M259L probably benign Het
Olfr640 T C 7: 104,022,232 I29V probably benign Het
Pfpl A T 19: 12,429,663 H426L probably benign Het
Poteg A G 8: 27,456,798 D238G probably damaging Het
Psen1 T C 12: 83,731,700 F386L probably damaging Het
Rassf9 A T 10: 102,545,044 I96F probably damaging Het
Robo1 T C 16: 73,043,189 probably null Het
Slc16a4 A T 3: 107,298,964 M117L probably benign Het
Slc4a8 A G 15: 100,791,625 N372S possibly damaging Het
Stmn4 G A 14: 66,356,299 G47D probably benign Het
Tex26 A G 5: 149,463,147 N137S possibly damaging Het
Ttn T A 2: 76,916,819 I4629F probably benign Het
Ubash3a G A 17: 31,208,232 probably null Het
Ube2cbp T C 9: 86,425,348 I233V probably benign Het
Utrn T A 10: 12,421,625 T680S probably damaging Het
Vps13d G A 4: 145,100,070 T2846I probably benign Het
Zfp41 C T 15: 75,618,708 P170S probably damaging Het
Other mutations in Zbtb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Zbtb22 APN 17 33917013 missense probably damaging 1.00
PIT4515001:Zbtb22 UTSW 17 33918698 missense probably benign 0.00
R0539:Zbtb22 UTSW 17 33918144 missense possibly damaging 0.93
R0972:Zbtb22 UTSW 17 33917352 missense possibly damaging 0.57
R2217:Zbtb22 UTSW 17 33917965 missense probably damaging 1.00
R2218:Zbtb22 UTSW 17 33917965 missense probably damaging 1.00
R2520:Zbtb22 UTSW 17 33916982 missense probably damaging 1.00
R3806:Zbtb22 UTSW 17 33916946 unclassified probably benign
R4086:Zbtb22 UTSW 17 33918168 missense probably damaging 0.99
R5004:Zbtb22 UTSW 17 33917243 missense probably benign 0.29
R5141:Zbtb22 UTSW 17 33918636 missense possibly damaging 0.81
R5158:Zbtb22 UTSW 17 33918449 missense probably damaging 0.97
R5677:Zbtb22 UTSW 17 33917735 missense probably benign
R6358:Zbtb22 UTSW 17 33918737 missense probably damaging 1.00
R6495:Zbtb22 UTSW 17 33917250 missense probably damaging 1.00
R6975:Zbtb22 UTSW 17 33917964 missense probably damaging 1.00
R7561:Zbtb22 UTSW 17 33917978 missense probably benign 0.01
R7658:Zbtb22 UTSW 17 33918497 missense probably damaging 0.99
R7664:Zbtb22 UTSW 17 33918579 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATGCATCTCAACCTGCGAC -3'
(R):5'- ATTGCCTGCTCTTCAGTGTG -3'

Sequencing Primer
(F):5'- AACCTGCGACCCTTTGACTG -3'
(R):5'- GTGTGCTGCACCTCCAC -3'
Posted On2016-12-15