Incidental Mutation 'R5805:Rnf19b'
ID448440
Institutional Source Beutler Lab
Gene Symbol Rnf19b
Ensembl Gene ENSMUSG00000028793
Gene Namering finger protein 19B
Synonyms4930555L03Rik, Ibrdc3, 4930534K13Rik
MMRRC Submission 043212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R5805 (G1)
Quality Score144
Status Not validated
Chromosome4
Chromosomal Location129058271-129085886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129058824 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 185 (Y185C)
Ref Sequence ENSEMBL: ENSMUSP00000131373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030584] [ENSMUST00000097874] [ENSMUST00000152565] [ENSMUST00000168461]
Predicted Effect probably damaging
Transcript: ENSMUST00000030584
AA Change: Y185C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030584
Gene: ENSMUSG00000028793
AA Change: Y185C

DomainStartEndE-ValueType
low complexity region 52 115 N/A INTRINSIC
RING 116 163 4.84e-3 SMART
IBR 183 248 5.61e-24 SMART
IBR 251 330 6.35e-2 SMART
transmembrane domain 356 378 N/A INTRINSIC
transmembrane domain 399 421 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 616 633 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097874
AA Change: Y4C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095484
Gene: ENSMUSG00000028793
AA Change: Y4C

DomainStartEndE-ValueType
IBR 2 67 5.61e-24 SMART
IBR 70 149 6.35e-2 SMART
transmembrane domain 175 197 N/A INTRINSIC
transmembrane domain 218 240 N/A INTRINSIC
low complexity region 330 353 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149472
Predicted Effect probably damaging
Transcript: ENSMUST00000152565
AA Change: Y4C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119611
Gene: ENSMUSG00000028793
AA Change: Y4C

DomainStartEndE-ValueType
IBR 2 67 5.61e-24 SMART
IBR 70 148 4.95e-2 SMART
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
low complexity region 329 352 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168461
AA Change: Y185C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131373
Gene: ENSMUSG00000028793
AA Change: Y185C

DomainStartEndE-ValueType
low complexity region 52 115 N/A INTRINSIC
RING 116 163 4.84e-3 SMART
IBR 183 248 5.61e-24 SMART
IBR 251 329 4.95e-2 SMART
transmembrane domain 355 377 N/A INTRINSIC
transmembrane domain 398 420 N/A INTRINSIC
low complexity region 510 533 N/A INTRINSIC
low complexity region 615 632 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein containing two RING-type and one IBR-type zinc finger motifs. The encoded protin is an E3 ubiquitin-protein ligase that plays a role in the cytotoxic effects of natural killer (NK) cells. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes X and Y in a possible pseudoautosomal region. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired NK cell cytolysis and an impaired ability to control introduced tumor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 C T 11: 110,279,390 C1293Y probably benign Het
Adam8 T A 7: 139,985,881 D611V probably damaging Het
Arhgap33 T C 7: 30,526,414 T576A probably benign Het
Atf7 A T 15: 102,557,587 probably null Het
Baiap3 T A 17: 25,247,515 T464S probably benign Het
Ccdc40 T C 11: 119,246,080 probably null Het
Celf2 T C 2: 6,553,787 E430G probably damaging Het
Chia1 A G 3: 106,128,476 T211A probably damaging Het
Ciz1 T C 2: 32,367,396 F151S probably damaging Het
Dnm2 A G 9: 21,467,669 T175A probably damaging Het
Doc2b A G 11: 75,772,538 S363P probably damaging Het
Garem1 C T 18: 21,148,435 R288H probably benign Het
Gm15448 G A 7: 3,822,623 L416F probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Helz2 C A 2: 181,240,508 C164F probably damaging Het
Itfg1 A T 8: 85,766,972 S293T probably benign Het
Kcnn2 T A 18: 45,683,131 D336E probably damaging Het
Kifc2 C T 15: 76,662,153 A245V probably benign Het
Krt18 T A 15: 102,031,300 I311N probably benign Het
Lypla1 T C 1: 4,830,294 M7T possibly damaging Het
Mef2a T C 7: 67,251,668 M285V possibly damaging Het
Micu1 A C 10: 59,827,306 K353Q possibly damaging Het
Mpv17l A G 16: 13,942,149 probably benign Het
Ntrk1 G A 3: 87,780,172 R652W probably damaging Het
Olfr1212 G A 2: 88,958,641 M58I possibly damaging Het
Olfr155 T C 4: 43,855,152 I281T probably benign Het
Olfr61 T A 7: 140,638,471 F257I probably benign Het
Pcdh15 C A 10: 74,230,259 T252K probably damaging Het
Pcsk5 T C 19: 17,456,829 M1392V probably benign Het
Phf20 T A 2: 156,307,294 V964E probably damaging Het
Plcg2 T C 8: 117,598,495 probably null Het
Pqlc1 C T 18: 80,263,443 P76L probably damaging Het
Rnf10 A T 5: 115,244,068 C693S probably benign Het
Ros1 G T 10: 52,123,289 D1167E probably damaging Het
Sidt2 G A 9: 45,942,199 S701L probably damaging Het
Spag1 T C 15: 36,200,284 I345T probably damaging Het
Srcap T A 7: 127,542,039 S1603T possibly damaging Het
Stag1 T A 9: 100,796,778 Y251N probably damaging Het
Stxbp5 T C 10: 9,900,586 N33S probably benign Het
Tnrc6a T C 7: 123,170,076 L363P probably damaging Het
U2surp C T 9: 95,479,304 R591H possibly damaging Het
Usf3 A G 16: 44,220,746 N1863S possibly damaging Het
Vmn2r15 T C 5: 109,286,940 I633V possibly damaging Het
Zfp979 T C 4: 147,613,610 D214G probably damaging Het
Other mutations in Rnf19b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Rnf19b APN 4 129071789 missense probably damaging 1.00
IGL01478:Rnf19b APN 4 129058830 missense probably damaging 1.00
IGL01511:Rnf19b APN 4 129080418 missense probably damaging 1.00
IGL02052:Rnf19b APN 4 129071820 missense probably damaging 1.00
IGL02576:Rnf19b APN 4 129073522 nonsense probably null
IGL03140:Rnf19b APN 4 129084096 missense probably benign 0.01
PIT4519001:Rnf19b UTSW 4 129075653 missense probably damaging 1.00
R0632:Rnf19b UTSW 4 129073551 missense probably damaging 1.00
R1187:Rnf19b UTSW 4 129075567 splice site probably null
R1500:Rnf19b UTSW 4 129078961 missense probably damaging 1.00
R4560:Rnf19b UTSW 4 129071823 missense probably damaging 1.00
R5185:Rnf19b UTSW 4 129083920 nonsense probably null
R5726:Rnf19b UTSW 4 129071892 missense possibly damaging 0.83
R6737:Rnf19b UTSW 4 129085551 unclassified probably benign
R6941:Rnf19b UTSW 4 129082779 missense probably benign 0.01
R7235:Rnf19b UTSW 4 129083778 missense
Z1176:Rnf19b UTSW 4 129078905 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCCGAGAAGGACTCCGAGTC -3'
(R):5'- TCGGTTACTCGTGATCGTCC -3'

Sequencing Primer
(F):5'- ACCCTAAGTGCCGCAGC -3'
(R):5'- GTTACTCGTGATCGTCCGTCCTC -3'
Posted On2016-12-15