Incidental Mutation 'R5805:Arhgap33'
ID448445
Institutional Source Beutler Lab
Gene Symbol Arhgap33
Ensembl Gene ENSMUSG00000036882
Gene NameRho GTPase activating protein 33
SynonymsSnx26, NOMA-GAP, Tcgap
MMRRC Submission 043212-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R5805 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30522226-30535060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30526414 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 576 (T576A)
Ref Sequence ENSEMBL: ENSMUSP00000146767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044338] [ENSMUST00000207858] [ENSMUST00000207860] [ENSMUST00000208522] [ENSMUST00000208538]
Predicted Effect probably benign
Transcript: ENSMUST00000044338
AA Change: T576A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000038412
Gene: ENSMUSG00000036882
AA Change: T576A

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
SH3 213 271 5.32e-12 SMART
low complexity region 318 335 N/A INTRINSIC
RhoGAP 350 531 4.05e-67 SMART
low complexity region 582 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 694 733 N/A INTRINSIC
low complexity region 770 798 N/A INTRINSIC
low complexity region 832 850 N/A INTRINSIC
low complexity region 894 940 N/A INTRINSIC
low complexity region 979 988 N/A INTRINSIC
low complexity region 1076 1086 N/A INTRINSIC
low complexity region 1158 1166 N/A INTRINSIC
low complexity region 1194 1216 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207637
Predicted Effect probably benign
Transcript: ENSMUST00000207858
AA Change: T552A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000207860
AA Change: T576A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000208522
Predicted Effect probably benign
Transcript: ENSMUST00000208538
AA Change: T576A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Alternative splice variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display region specific thinning of the cerebral cortex with reduced dendritic complexity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 C T 11: 110,279,390 C1293Y probably benign Het
Adam8 T A 7: 139,985,881 D611V probably damaging Het
Atf7 A T 15: 102,557,587 probably null Het
Baiap3 T A 17: 25,247,515 T464S probably benign Het
Ccdc40 T C 11: 119,246,080 probably null Het
Celf2 T C 2: 6,553,787 E430G probably damaging Het
Chia1 A G 3: 106,128,476 T211A probably damaging Het
Ciz1 T C 2: 32,367,396 F151S probably damaging Het
Dnm2 A G 9: 21,467,669 T175A probably damaging Het
Doc2b A G 11: 75,772,538 S363P probably damaging Het
Garem1 C T 18: 21,148,435 R288H probably benign Het
Gm15448 G A 7: 3,822,623 L416F probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Helz2 C A 2: 181,240,508 C164F probably damaging Het
Itfg1 A T 8: 85,766,972 S293T probably benign Het
Kcnn2 T A 18: 45,683,131 D336E probably damaging Het
Kifc2 C T 15: 76,662,153 A245V probably benign Het
Krt18 T A 15: 102,031,300 I311N probably benign Het
Lypla1 T C 1: 4,830,294 M7T possibly damaging Het
Mef2a T C 7: 67,251,668 M285V possibly damaging Het
Micu1 A C 10: 59,827,306 K353Q possibly damaging Het
Mpv17l A G 16: 13,942,149 probably benign Het
Ntrk1 G A 3: 87,780,172 R652W probably damaging Het
Olfr1212 G A 2: 88,958,641 M58I possibly damaging Het
Olfr155 T C 4: 43,855,152 I281T probably benign Het
Olfr61 T A 7: 140,638,471 F257I probably benign Het
Pcdh15 C A 10: 74,230,259 T252K probably damaging Het
Pcsk5 T C 19: 17,456,829 M1392V probably benign Het
Phf20 T A 2: 156,307,294 V964E probably damaging Het
Plcg2 T C 8: 117,598,495 probably null Het
Pqlc1 C T 18: 80,263,443 P76L probably damaging Het
Rnf10 A T 5: 115,244,068 C693S probably benign Het
Rnf19b A G 4: 129,058,824 Y185C probably damaging Het
Ros1 G T 10: 52,123,289 D1167E probably damaging Het
Sidt2 G A 9: 45,942,199 S701L probably damaging Het
Spag1 T C 15: 36,200,284 I345T probably damaging Het
Srcap T A 7: 127,542,039 S1603T possibly damaging Het
Stag1 T A 9: 100,796,778 Y251N probably damaging Het
Stxbp5 T C 10: 9,900,586 N33S probably benign Het
Tnrc6a T C 7: 123,170,076 L363P probably damaging Het
U2surp C T 9: 95,479,304 R591H possibly damaging Het
Usf3 A G 16: 44,220,746 N1863S possibly damaging Het
Vmn2r15 T C 5: 109,286,940 I633V possibly damaging Het
Zfp979 T C 4: 147,613,610 D214G probably damaging Het
Other mutations in Arhgap33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Arhgap33 APN 7 30529946 missense probably damaging 0.99
IGL02176:Arhgap33 APN 7 30524051 missense possibly damaging 0.76
IGL02430:Arhgap33 APN 7 30522760 missense probably benign 0.07
IGL03091:Arhgap33 APN 7 30528293 missense probably damaging 1.00
R0276:Arhgap33 UTSW 7 30523244 missense probably benign 0.01
R0494:Arhgap33 UTSW 7 30524496 missense probably damaging 0.98
R0597:Arhgap33 UTSW 7 30526446 missense probably damaging 1.00
R0717:Arhgap33 UTSW 7 30528349 missense probably damaging 1.00
R1661:Arhgap33 UTSW 7 30532323 missense probably damaging 1.00
R1761:Arhgap33 UTSW 7 30533063 intron probably null
R1882:Arhgap33 UTSW 7 30522809 missense probably damaging 1.00
R2161:Arhgap33 UTSW 7 30528650 splice site probably null
R2566:Arhgap33 UTSW 7 30527229 missense probably damaging 1.00
R4353:Arhgap33 UTSW 7 30524136 missense possibly damaging 0.95
R4552:Arhgap33 UTSW 7 30519108 unclassified probably benign
R4778:Arhgap33 UTSW 7 30532093 missense probably benign
R4887:Arhgap33 UTSW 7 30532192 missense probably damaging 0.99
R4957:Arhgap33 UTSW 7 30532361 missense probably damaging 0.96
R5001:Arhgap33 UTSW 7 30533016 missense possibly damaging 0.95
R5140:Arhgap33 UTSW 7 30528301 missense probably damaging 1.00
R5585:Arhgap33 UTSW 7 30523835 missense probably benign 0.00
R5704:Arhgap33 UTSW 7 30519620 unclassified probably benign
R6476:Arhgap33 UTSW 7 30524412 missense probably damaging 0.99
R6485:Arhgap33 UTSW 7 30524004 missense probably benign
R6572:Arhgap33 UTSW 7 30527210 missense probably damaging 1.00
R7183:Arhgap33 UTSW 7 30525871 intron probably null
R7205:Arhgap33 UTSW 7 30533009 missense probably damaging 0.99
R7241:Arhgap33 UTSW 7 30528721 missense probably damaging 1.00
R7259:Arhgap33 UTSW 7 30532200 missense probably damaging 1.00
R7319:Arhgap33 UTSW 7 30526369 missense probably benign
R7384:Arhgap33 UTSW 7 30527271 missense probably damaging 1.00
R7412:Arhgap33 UTSW 7 30523052 missense probably benign 0.00
R7693:Arhgap33 UTSW 7 30526112 critical splice donor site probably null
X0034:Arhgap33 UTSW 7 30524449 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCCCCAGAGCAAAGAATGTC -3'
(R):5'- AATTCCCGCCTGATCTACAC -3'

Sequencing Primer
(F):5'- GCAAAGAATGTCTTCCAGCTG -3'
(R):5'- TGATCTACACCGGCCCC -3'
Posted On2016-12-15