Mutagenetix > Incidental Mutations

Incidental Mutation 'R5805:Adam8'

448450

Institutional Source

Beutler Lab

Gene Symbol

Adam8

Ensembl Gene

ENSMUSG00000025473

Gene Name

a disintegrin and metallopeptidase domain 8

Synonyms

CD156, MS2, E430039A18Rik, CD156a

MMRRC Submission

043212-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5805 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139978932-139992562 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139985881 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 611 (D611V)

Ref Sequence

ENSEMBL: ENSMUSP00000117858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000106069] [ENSMUST00000148670] [ENSMUST00000173209]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026546
AA Change: D605V

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473
AA Change: D605V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:Pep_M12B_propep	26	151	5.9e-35	PFAM
Pfam:Reprolysin_5	193	371	1e-22	PFAM
Pfam:Reprolysin_4	193	384	1.7e-16	PFAM
Pfam:Reprolysin	195	394	2.7e-70	PFAM
Pfam:Reprolysin_2	214	384	1.6e-16	PFAM
Pfam:Reprolysin_3	218	339	4.9e-21	PFAM
DISIN	411	486	5.16e-36	SMART
ACR	487	606	2.15e-35	SMART
EGF	613	642	3.06e-1	SMART
transmembrane domain	660	682	N/A	INTRINSIC
low complexity region	732	762	N/A	INTRINSIC
low complexity region	770	783	N/A	INTRINSIC
low complexity region	784	812	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106069
AA Change: D606V

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473
AA Change: D606V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:Pep_M12B_propep	28	152	4e-30	PFAM
Pfam:Reprolysin_5	194	372	9.6e-23	PFAM
Pfam:Reprolysin_4	194	385	1.6e-16	PFAM
Pfam:Reprolysin	196	395	2.2e-73	PFAM
Pfam:Reprolysin_2	215	385	2.9e-18	PFAM
Pfam:Reprolysin_3	219	340	6.6e-21	PFAM
DISIN	412	487	5.16e-36	SMART
ACR	488	607	2.15e-35	SMART
EGF	614	643	3.06e-1	SMART
transmembrane domain	661	683	N/A	INTRINSIC
low complexity region	733	763	N/A	INTRINSIC
low complexity region	771	784	N/A	INTRINSIC
low complexity region	785	813	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128332

Predicted Effect

probably damaging
Transcript: ENSMUST00000148670
AA Change: D611V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117858
Gene: ENSMUSG00000025473
AA Change: D611V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:Pep_M12B_propep	26	151	1.8e-35	PFAM
Pfam:Reprolysin_5	193	371	3.6e-23	PFAM
Pfam:Reprolysin_4	193	384	6e-17	PFAM
Pfam:Reprolysin	195	394	8.2e-71	PFAM
Pfam:Reprolysin_2	214	384	5.8e-17	PFAM
Pfam:Reprolysin_3	218	339	1.7e-21	PFAM
DISIN	411	486	5.16e-36	SMART
ACR	487	612	2.21e-32	SMART
EGF	619	648	3.06e-1	SMART
transmembrane domain	666	688	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149915

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156647

Predicted Effect

probably benign
Transcript: ENSMUST00000173209

SMART Domains

Protein: ENSMUSP00000133673
Gene: ENSMUSG00000025473

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	31	45	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185038

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the Adam family of proteins that contain the disintegrin and metalloprotease domains. The encoded protein is localized to the cell surface, where it is involved in the remodeling of extracellular matrix and cell migration. Mice lacking the encoded protein display persistent inflammation upon treatment with allergens. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological or pathological abnormalities. Mice homozygous for a different knock-out allele exhibit reduced osteoclast differentiation and calvarial fibrosis in response to TNF-alpha treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	C	T	11: 110,279,390	C1293Y	probably benign	Het
Arhgap33	T	C	7: 30,526,414	T576A	probably benign	Het
Atf7	A	T	15: 102,557,587		probably null	Het
Baiap3	T	A	17: 25,247,515	T464S	probably benign	Het
Ccdc40	T	C	11: 119,246,080		probably null	Het
Celf2	T	C	2: 6,553,787	E430G	probably damaging	Het
Chia1	A	G	3: 106,128,476	T211A	probably damaging	Het
Ciz1	T	C	2: 32,367,396	F151S	probably damaging	Het
Dnm2	A	G	9: 21,467,669	T175A	probably damaging	Het
Doc2b	A	G	11: 75,772,538	S363P	probably damaging	Het
Garem1	C	T	18: 21,148,435	R288H	probably benign	Het
Gm15448	G	A	7: 3,822,623	L416F	probably benign	Het
Gpr132	G	A	12: 112,852,796	R137C	probably damaging	Het
Helz2	C	A	2: 181,240,508	C164F	probably damaging	Het
Itfg1	A	T	8: 85,766,972	S293T	probably benign	Het
Kcnn2	T	A	18: 45,683,131	D336E	probably damaging	Het
Kifc2	C	T	15: 76,662,153	A245V	probably benign	Het
Krt18	T	A	15: 102,031,300	I311N	probably benign	Het
Lypla1	T	C	1: 4,830,294	M7T	possibly damaging	Het
Mef2a	T	C	7: 67,251,668	M285V	possibly damaging	Het
Micu1	A	C	10: 59,827,306	K353Q	possibly damaging	Het
Mpv17l	A	G	16: 13,942,149		probably benign	Het
Ntrk1	G	A	3: 87,780,172	R652W	probably damaging	Het
Olfr1212	G	A	2: 88,958,641	M58I	possibly damaging	Het
Olfr155	T	C	4: 43,855,152	I281T	probably benign	Het
Olfr61	T	A	7: 140,638,471	F257I	probably benign	Het
Pcdh15	C	A	10: 74,230,259	T252K	probably damaging	Het
Pcsk5	T	C	19: 17,456,829	M1392V	probably benign	Het
Phf20	T	A	2: 156,307,294	V964E	probably damaging	Het
Plcg2	T	C	8: 117,598,495		probably null	Het
Pqlc1	C	T	18: 80,263,443	P76L	probably damaging	Het
Rnf10	A	T	5: 115,244,068	C693S	probably benign	Het
Rnf19b	A	G	4: 129,058,824	Y185C	probably damaging	Het
Ros1	G	T	10: 52,123,289	D1167E	probably damaging	Het
Sidt2	G	A	9: 45,942,199	S701L	probably damaging	Het
Spag1	T	C	15: 36,200,284	I345T	probably damaging	Het
Srcap	T	A	7: 127,542,039	S1603T	possibly damaging	Het
Stag1	T	A	9: 100,796,778	Y251N	probably damaging	Het
Stxbp5	T	C	10: 9,900,586	N33S	probably benign	Het
Tnrc6a	T	C	7: 123,170,076	L363P	probably damaging	Het
U2surp	C	T	9: 95,479,304	R591H	possibly damaging	Het
Usf3	A	G	16: 44,220,746	N1863S	possibly damaging	Het
Vmn2r15	T	C	5: 109,286,940	I633V	possibly damaging	Het
Zfp979	T	C	4: 147,613,610	D214G	probably damaging	Het

Other mutations in Adam8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:Adam8	APN	7	139987245	missense	probably damaging	1.00
IGL02044:Adam8	APN	7	139982822	missense	possibly damaging	0.85
IGL02228:Adam8	APN	7	139988806	splice site	probably null
IGL02257:Adam8	APN	7	139987648	missense	possibly damaging	0.88
IGL03101:Adam8	APN	7	139988543	missense	possibly damaging	0.56
R0320:Adam8	UTSW	7	139986442	missense	probably damaging	1.00
R0384:Adam8	UTSW	7	139986812	unclassified	probably benign
R1169:Adam8	UTSW	7	139983929	missense	probably benign	0.11
R1340:Adam8	UTSW	7	139991377	missense	probably damaging	0.99
R1699:Adam8	UTSW	7	139983311	missense	possibly damaging	0.72
R3725:Adam8	UTSW	7	139983868	missense	possibly damaging	0.63
R3874:Adam8	UTSW	7	139987607	missense	probably damaging	1.00
R4716:Adam8	UTSW	7	139983938	missense	probably benign	0.31
R4754:Adam8	UTSW	7	139984780	missense	possibly damaging	0.87
R4907:Adam8	UTSW	7	139989373	missense	probably benign	0.03
R5345:Adam8	UTSW	7	139987639	missense	probably benign	0.03
R5579:Adam8	UTSW	7	139988984	missense	probably benign	0.03
R5696:Adam8	UTSW	7	139989246	missense	probably benign	0.03
R5948:Adam8	UTSW	7	139987884	missense	probably benign	0.07
R5991:Adam8	UTSW	7	139990287	missense	probably damaging	1.00
R6280:Adam8	UTSW	7	139984807	missense	probably damaging	0.99
R6456:Adam8	UTSW	7	139986788	missense	possibly damaging	0.96
R7098:Adam8	UTSW	7	139979499	missense	possibly damaging	0.53
R7105:Adam8	UTSW	7	139990055	missense	probably benign	0.00
R7334:Adam8	UTSW	7	139988990	missense	probably damaging	1.00
R7342:Adam8	UTSW	7	139986391	missense	probably benign	0.00
R7382:Adam8	UTSW	7	139990107	missense	possibly damaging	0.74
R7425:Adam8	UTSW	7	139992481	unclassified	probably benign
R7507:Adam8	UTSW	7	139987178	critical splice donor site	probably null
R7637:Adam8	UTSW	7	139985430	missense	probably damaging	0.98
R7904:Adam8	UTSW	7	139987678	missense	probably benign	0.17
R7987:Adam8	UTSW	7	139987678	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TAATCTGAACCCACATTGCTGTACC -3'
(R):5'- AGGATCAGCCAGTCTAGTGC -3'

Sequencing Primer
(F):5'- GTACCCACAGCTGTCTCTG -3'
(R):5'- GCCAGTCTAGTGCCACCTCATG -3'

Posted On

2016-12-15