Incidental Mutation 'R5805:Itfg1'
ID448452
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
MMRRC Submission 043212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5805 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85766972 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 293 (S293T)
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect probably benign
Transcript: ENSMUST00000034140
AA Change: S293T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: S293T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210912
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 C T 11: 110,279,390 C1293Y probably benign Het
Adam8 T A 7: 139,985,881 D611V probably damaging Het
Arhgap33 T C 7: 30,526,414 T576A probably benign Het
Atf7 A T 15: 102,557,587 probably null Het
Baiap3 T A 17: 25,247,515 T464S probably benign Het
Ccdc40 T C 11: 119,246,080 probably null Het
Celf2 T C 2: 6,553,787 E430G probably damaging Het
Chia1 A G 3: 106,128,476 T211A probably damaging Het
Ciz1 T C 2: 32,367,396 F151S probably damaging Het
Dnm2 A G 9: 21,467,669 T175A probably damaging Het
Doc2b A G 11: 75,772,538 S363P probably damaging Het
Garem1 C T 18: 21,148,435 R288H probably benign Het
Gm15448 G A 7: 3,822,623 L416F probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Helz2 C A 2: 181,240,508 C164F probably damaging Het
Kcnn2 T A 18: 45,683,131 D336E probably damaging Het
Kifc2 C T 15: 76,662,153 A245V probably benign Het
Krt18 T A 15: 102,031,300 I311N probably benign Het
Lypla1 T C 1: 4,830,294 M7T possibly damaging Het
Mef2a T C 7: 67,251,668 M285V possibly damaging Het
Micu1 A C 10: 59,827,306 K353Q possibly damaging Het
Mpv17l A G 16: 13,942,149 probably benign Het
Ntrk1 G A 3: 87,780,172 R652W probably damaging Het
Olfr1212 G A 2: 88,958,641 M58I possibly damaging Het
Olfr155 T C 4: 43,855,152 I281T probably benign Het
Olfr61 T A 7: 140,638,471 F257I probably benign Het
Pcdh15 C A 10: 74,230,259 T252K probably damaging Het
Pcsk5 T C 19: 17,456,829 M1392V probably benign Het
Phf20 T A 2: 156,307,294 V964E probably damaging Het
Plcg2 T C 8: 117,598,495 probably null Het
Pqlc1 C T 18: 80,263,443 P76L probably damaging Het
Rnf10 A T 5: 115,244,068 C693S probably benign Het
Rnf19b A G 4: 129,058,824 Y185C probably damaging Het
Ros1 G T 10: 52,123,289 D1167E probably damaging Het
Sidt2 G A 9: 45,942,199 S701L probably damaging Het
Spag1 T C 15: 36,200,284 I345T probably damaging Het
Srcap T A 7: 127,542,039 S1603T possibly damaging Het
Stag1 T A 9: 100,796,778 Y251N probably damaging Het
Stxbp5 T C 10: 9,900,586 N33S probably benign Het
Tnrc6a T C 7: 123,170,076 L363P probably damaging Het
U2surp C T 9: 95,479,304 R591H possibly damaging Het
Usf3 A G 16: 44,220,746 N1863S possibly damaging Het
Vmn2r15 T C 5: 109,286,940 I633V possibly damaging Het
Zfp979 T C 4: 147,613,610 D214G probably damaging Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0368:Itfg1 UTSW 8 85764407 missense probably damaging 1.00
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2260:Itfg1 UTSW 8 85722677 missense probably damaging 1.00
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2876:Itfg1 UTSW 8 85780510 splice site probably benign
R2990:Itfg1 UTSW 8 85835049 missense possibly damaging 0.82
R4484:Itfg1 UTSW 8 85726249 missense probably damaging 1.00
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5146:Itfg1 UTSW 8 85718868 makesense probably null
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6492:Itfg1 UTSW 8 85740349 missense probably benign 0.14
R6588:Itfg1 UTSW 8 85736130 missense probably benign
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
R7912:Itfg1 UTSW 8 85764280 missense probably damaging 1.00
R7985:Itfg1 UTSW 8 85725568 missense probably damaging 1.00
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCATTTTCTACCTCAGTAGCAC -3'
(R):5'- CAGCCCTGTGTCAAGTTGTTTG -3'

Sequencing Primer
(F):5'- CATTTTCTACCTCAGTAGCACAAAAG -3'
(R):5'- CAAGTTGTTTGGTGTTATCCAGAC -3'
Posted On2016-12-15