Incidental Mutation 'R5805:Stag1'
ID448457
Institutional Source Beutler Lab
Gene Symbol Stag1
Ensembl Gene ENSMUSG00000037286
Gene Namestromal antigen 1
SynonymsScc3, SA-1
MMRRC Submission 043212-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5805 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location100597798-100959375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100796778 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 251 (Y251N)
Ref Sequence ENSEMBL: ENSMUSP00000116322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041418] [ENSMUST00000123302] [ENSMUST00000129269] [ENSMUST00000138405] [ENSMUST00000146312] [ENSMUST00000155108]
Predicted Effect probably damaging
Transcript: ENSMUST00000041418
AA Change: Y251N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040724
Gene: ENSMUSG00000037286
AA Change: Y251N

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 1.5e-50 PFAM
SCOP:d1qbkb_ 279 850 4e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123302
AA Change: Y251N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117879
Gene: ENSMUSG00000037286
AA Change: Y251N

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 2.9e-51 PFAM
low complexity region 303 315 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129269
AA Change: Y251N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116205
Gene: ENSMUSG00000037286
AA Change: Y251N

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 160 274 3.8e-41 PFAM
SCOP:d1qbkb_ 279 850 3e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138405
AA Change: Y251N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116322
Gene: ENSMUSG00000037286
AA Change: Y251N

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 1.5e-51 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146312
AA Change: Y193N
SMART Domains Protein: ENSMUSP00000116597
Gene: ENSMUSG00000037286
AA Change: Y193N

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 99 196 4.2e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149771
Predicted Effect probably benign
Transcript: ENSMUST00000155108
SMART Domains Protein: ENSMUSP00000118952
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mouse embryos homozygous for a null mutation show developmental delay and die before birth. Heterozygous animals have shorter lifespan and earlier onset of tumourigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 C T 11: 110,279,390 C1293Y probably benign Het
Adam8 T A 7: 139,985,881 D611V probably damaging Het
Arhgap33 T C 7: 30,526,414 T576A probably benign Het
Atf7 A T 15: 102,557,587 probably null Het
Baiap3 T A 17: 25,247,515 T464S probably benign Het
Ccdc40 T C 11: 119,246,080 probably null Het
Celf2 T C 2: 6,553,787 E430G probably damaging Het
Chia1 A G 3: 106,128,476 T211A probably damaging Het
Ciz1 T C 2: 32,367,396 F151S probably damaging Het
Dnm2 A G 9: 21,467,669 T175A probably damaging Het
Doc2b A G 11: 75,772,538 S363P probably damaging Het
Garem1 C T 18: 21,148,435 R288H probably benign Het
Gm15448 G A 7: 3,822,623 L416F probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Helz2 C A 2: 181,240,508 C164F probably damaging Het
Itfg1 A T 8: 85,766,972 S293T probably benign Het
Kcnn2 T A 18: 45,683,131 D336E probably damaging Het
Kifc2 C T 15: 76,662,153 A245V probably benign Het
Krt18 T A 15: 102,031,300 I311N probably benign Het
Lypla1 T C 1: 4,830,294 M7T possibly damaging Het
Mef2a T C 7: 67,251,668 M285V possibly damaging Het
Micu1 A C 10: 59,827,306 K353Q possibly damaging Het
Mpv17l A G 16: 13,942,149 probably benign Het
Ntrk1 G A 3: 87,780,172 R652W probably damaging Het
Olfr1212 G A 2: 88,958,641 M58I possibly damaging Het
Olfr155 T C 4: 43,855,152 I281T probably benign Het
Olfr61 T A 7: 140,638,471 F257I probably benign Het
Pcdh15 C A 10: 74,230,259 T252K probably damaging Het
Pcsk5 T C 19: 17,456,829 M1392V probably benign Het
Phf20 T A 2: 156,307,294 V964E probably damaging Het
Plcg2 T C 8: 117,598,495 probably null Het
Pqlc1 C T 18: 80,263,443 P76L probably damaging Het
Rnf10 A T 5: 115,244,068 C693S probably benign Het
Rnf19b A G 4: 129,058,824 Y185C probably damaging Het
Ros1 G T 10: 52,123,289 D1167E probably damaging Het
Sidt2 G A 9: 45,942,199 S701L probably damaging Het
Spag1 T C 15: 36,200,284 I345T probably damaging Het
Srcap T A 7: 127,542,039 S1603T possibly damaging Het
Stxbp5 T C 10: 9,900,586 N33S probably benign Het
Tnrc6a T C 7: 123,170,076 L363P probably damaging Het
U2surp C T 9: 95,479,304 R591H possibly damaging Het
Usf3 A G 16: 44,220,746 N1863S possibly damaging Het
Vmn2r15 T C 5: 109,286,940 I633V possibly damaging Het
Zfp979 T C 4: 147,613,610 D214G probably damaging Het
Other mutations in Stag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Stag1 APN 9 100776808 missense probably damaging 1.00
IGL01010:Stag1 APN 9 100945933 missense probably benign 0.06
IGL01012:Stag1 APN 9 100855859 missense possibly damaging 0.47
IGL01025:Stag1 APN 9 100951657 missense possibly damaging 0.95
IGL01307:Stag1 APN 9 100951788 intron probably benign
IGL02149:Stag1 APN 9 100887389 missense probably benign 0.09
IGL02608:Stag1 APN 9 100757769 missense probably null 0.99
IGL03008:Stag1 APN 9 100776791 missense probably damaging 1.00
IGL03210:Stag1 APN 9 100845076 missense possibly damaging 0.63
eto_o UTSW 9 100796716 missense probably damaging 1.00
PIT4280001:Stag1 UTSW 9 100942716 missense possibly damaging 0.95
R0070:Stag1 UTSW 9 100956408 missense probably null 1.00
R0070:Stag1 UTSW 9 100956408 missense probably null 1.00
R0349:Stag1 UTSW 9 100776784 missense probably damaging 0.98
R0479:Stag1 UTSW 9 100928091 missense probably benign 0.00
R0531:Stag1 UTSW 9 100954247 makesense probably null
R0962:Stag1 UTSW 9 100796827 missense probably damaging 1.00
R0976:Stag1 UTSW 9 100776824 missense probably damaging 0.98
R0976:Stag1 UTSW 9 100930016 critical splice donor site probably null
R1170:Stag1 UTSW 9 100888453 intron probably benign
R1499:Stag1 UTSW 9 100855832 missense possibly damaging 0.77
R1499:Stag1 UTSW 9 100887373 intron probably benign
R1644:Stag1 UTSW 9 100880900 intron probably benign
R1747:Stag1 UTSW 9 100888300 missense probably benign
R1799:Stag1 UTSW 9 100953462 intron probably null
R1807:Stag1 UTSW 9 100908666 missense probably benign 0.34
R1978:Stag1 UTSW 9 100888086 missense probably benign 0.03
R2029:Stag1 UTSW 9 100786687 missense probably damaging 1.00
R2161:Stag1 UTSW 9 100889595 missense probably damaging 1.00
R2300:Stag1 UTSW 9 100712500 missense possibly damaging 0.92
R2327:Stag1 UTSW 9 100786613 missense possibly damaging 0.81
R2426:Stag1 UTSW 9 100845116 critical splice donor site probably null
R2448:Stag1 UTSW 9 100888409 missense probably benign 0.42
R2504:Stag1 UTSW 9 100866210 missense probably damaging 0.99
R3713:Stag1 UTSW 9 100889618 missense probably benign 0.01
R3835:Stag1 UTSW 9 100737982 missense probably damaging 0.97
R3862:Stag1 UTSW 9 100944785 missense probably benign 0.02
R4398:Stag1 UTSW 9 100956606 utr 3 prime probably benign
R4568:Stag1 UTSW 9 100848669 missense probably damaging 1.00
R4651:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4652:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4653:Stag1 UTSW 9 100796716 missense probably damaging 1.00
R4675:Stag1 UTSW 9 100848705 missense probably damaging 1.00
R4709:Stag1 UTSW 9 100738039 missense probably damaging 0.99
R4924:Stag1 UTSW 9 100796755 missense possibly damaging 0.67
R5018:Stag1 UTSW 9 100951619 missense probably benign 0.00
R5435:Stag1 UTSW 9 100953550 missense probably benign 0.03
R5460:Stag1 UTSW 9 100956453 splice site probably null
R6127:Stag1 UTSW 9 100951697 missense probably benign 0.05
R6313:Stag1 UTSW 9 100757733 missense probably damaging 1.00
R6597:Stag1 UTSW 9 100887420 missense probably benign 0.01
R6807:Stag1 UTSW 9 100944850 missense probably damaging 1.00
R7099:Stag1 UTSW 9 100944826 missense probably benign 0.02
R7167:Stag1 UTSW 9 100945889 missense probably benign 0.05
R7395:Stag1 UTSW 9 100796728 missense probably damaging 0.99
R7504:Stag1 UTSW 9 100888328 missense probably benign 0.09
R7663:Stag1 UTSW 9 100738138 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGAGATTAGTCTATTCCTGTCAG -3'
(R):5'- GACCCGTATGAATTTTCTATTGTCC -3'

Sequencing Primer
(F):5'- AGATTAGTCTATTCCTGTCAGTTACC -3'
(R):5'- AACTTTCTGTGCAGCCAAGG -3'
Posted On2016-12-15