Incidental Mutation 'R5805:Doc2b'
ID448462
Institutional Source Beutler Lab
Gene Symbol Doc2b
Ensembl Gene ENSMUSG00000020848
Gene Namedouble C2, beta
Synonyms
MMRRC Submission 043212-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5805 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75768966-75796049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75772538 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 363 (S363P)
Ref Sequence ENSEMBL: ENSMUSP00000021209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021209]
Predicted Effect probably damaging
Transcript: ENSMUST00000021209
AA Change: S363P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021209
Gene: ENSMUSG00000020848
AA Change: S363P

DomainStartEndE-ValueType
Blast:C2 9 38 8e-8 BLAST
low complexity region 41 77 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
C2 142 247 4.69e-21 SMART
C2 282 396 4.69e-21 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a calcium sensor involved in glucose-stimulated insulin secretion, spontaneous neurotransmitter release, and enhanced SNARE-dependent vesicle fusion. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced frequency of spontaneous neurotransmitter release events with cerebellar Purkinje cells showing continuous spiking without interruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 C T 11: 110,279,390 C1293Y probably benign Het
Adam8 T A 7: 139,985,881 D611V probably damaging Het
Arhgap33 T C 7: 30,526,414 T576A probably benign Het
Atf7 A T 15: 102,557,587 probably null Het
Baiap3 T A 17: 25,247,515 T464S probably benign Het
Ccdc40 T C 11: 119,246,080 probably null Het
Celf2 T C 2: 6,553,787 E430G probably damaging Het
Chia1 A G 3: 106,128,476 T211A probably damaging Het
Ciz1 T C 2: 32,367,396 F151S probably damaging Het
Dnm2 A G 9: 21,467,669 T175A probably damaging Het
Garem1 C T 18: 21,148,435 R288H probably benign Het
Gm15448 G A 7: 3,822,623 L416F probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Helz2 C A 2: 181,240,508 C164F probably damaging Het
Itfg1 A T 8: 85,766,972 S293T probably benign Het
Kcnn2 T A 18: 45,683,131 D336E probably damaging Het
Kifc2 C T 15: 76,662,153 A245V probably benign Het
Krt18 T A 15: 102,031,300 I311N probably benign Het
Lypla1 T C 1: 4,830,294 M7T possibly damaging Het
Mef2a T C 7: 67,251,668 M285V possibly damaging Het
Micu1 A C 10: 59,827,306 K353Q possibly damaging Het
Mpv17l A G 16: 13,942,149 probably benign Het
Ntrk1 G A 3: 87,780,172 R652W probably damaging Het
Olfr1212 G A 2: 88,958,641 M58I possibly damaging Het
Olfr155 T C 4: 43,855,152 I281T probably benign Het
Olfr61 T A 7: 140,638,471 F257I probably benign Het
Pcdh15 C A 10: 74,230,259 T252K probably damaging Het
Pcsk5 T C 19: 17,456,829 M1392V probably benign Het
Phf20 T A 2: 156,307,294 V964E probably damaging Het
Plcg2 T C 8: 117,598,495 probably null Het
Pqlc1 C T 18: 80,263,443 P76L probably damaging Het
Rnf10 A T 5: 115,244,068 C693S probably benign Het
Rnf19b A G 4: 129,058,824 Y185C probably damaging Het
Ros1 G T 10: 52,123,289 D1167E probably damaging Het
Sidt2 G A 9: 45,942,199 S701L probably damaging Het
Spag1 T C 15: 36,200,284 I345T probably damaging Het
Srcap T A 7: 127,542,039 S1603T possibly damaging Het
Stag1 T A 9: 100,796,778 Y251N probably damaging Het
Stxbp5 T C 10: 9,900,586 N33S probably benign Het
Tnrc6a T C 7: 123,170,076 L363P probably damaging Het
U2surp C T 9: 95,479,304 R591H possibly damaging Het
Usf3 A G 16: 44,220,746 N1863S possibly damaging Het
Vmn2r15 T C 5: 109,286,940 I633V possibly damaging Het
Zfp979 T C 4: 147,613,610 D214G probably damaging Het
Other mutations in Doc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0241:Doc2b UTSW 11 75772561 missense probably damaging 1.00
R0241:Doc2b UTSW 11 75772561 missense probably damaging 1.00
R0567:Doc2b UTSW 11 75780124 missense probably damaging 1.00
R1430:Doc2b UTSW 11 75780155 missense possibly damaging 0.80
R1539:Doc2b UTSW 11 75771957 missense probably damaging 1.00
R5109:Doc2b UTSW 11 75777141 missense probably benign 0.00
R5260:Doc2b UTSW 11 75786163 missense probably damaging 1.00
R5443:Doc2b UTSW 11 75780095 missense probably damaging 1.00
R5605:Doc2b UTSW 11 75771960 missense probably damaging 0.99
R5789:Doc2b UTSW 11 75786115 missense probably damaging 1.00
R6028:Doc2b UTSW 11 75772586 missense probably benign 0.04
R6146:Doc2b UTSW 11 75773595 missense probably damaging 1.00
R6295:Doc2b UTSW 11 75780267 missense probably damaging 0.99
R6295:Doc2b UTSW 11 75795625 missense probably benign 0.09
R6568:Doc2b UTSW 11 75776994 splice site probably null
Z1176:Doc2b UTSW 11 75777072 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGCCCACAGAAACTTGTGGTC -3'
(R):5'- CCCACATTGACCACCTTGAG -3'

Sequencing Primer
(F):5'- CACAGAAACTTGTGGTCCCATGG -3'
(R):5'- CATTGACCACCTTGAGGCTTGAG -3'
Posted On2016-12-15