Incidental Mutation 'R5806:Zfp143'
ID448509
Institutional Source Beutler Lab
Gene Symbol Zfp143
Ensembl Gene ENSMUSG00000061079
Gene Namezinc finger protein 143
SynonymsD7Ertd805e, KRAB14, pHZ-1, Staf, Zfp79, Zfp80-rs1
MMRRC Submission 043392-MU
Accession Numbers

NCBI RefSeq: NM_009281.3; MGI:1277969

Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location110061217-110095394 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 110086235 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 423 (K423*)
Ref Sequence ENSEMBL: ENSMUSP00000148235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084727] [ENSMUST00000169638] [ENSMUST00000209505] [ENSMUST00000211798]
Predicted Effect probably null
Transcript: ENSMUST00000084727
AA Change: K424*
SMART Domains Protein: ENSMUSP00000081778
Gene: ENSMUSG00000061079
AA Change: K424*

DomainStartEndE-ValueType
ZnF_C2H2 236 260 5.5e-3 SMART
ZnF_C2H2 266 290 6.42e-4 SMART
ZnF_C2H2 296 320 4.01e-5 SMART
ZnF_C2H2 326 350 1.38e-3 SMART
ZnF_C2H2 356 380 3.95e-4 SMART
ZnF_C2H2 386 410 2.4e-3 SMART
ZnF_C2H2 416 439 1.79e-2 SMART
low complexity region 443 457 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169638
AA Change: K396*
SMART Domains Protein: ENSMUSP00000126015
Gene: ENSMUSG00000061079
AA Change: K396*

DomainStartEndE-ValueType
ZnF_C2H2 209 233 5.5e-3 SMART
ZnF_C2H2 239 263 6.42e-4 SMART
ZnF_C2H2 269 293 4.01e-5 SMART
ZnF_C2H2 299 323 1.38e-3 SMART
ZnF_C2H2 329 353 3.95e-4 SMART
ZnF_C2H2 359 383 2.4e-3 SMART
ZnF_C2H2 389 412 1.79e-2 SMART
low complexity region 416 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect probably null
Transcript: ENSMUST00000209505
AA Change: K423*
Predicted Effect probably null
Transcript: ENSMUST00000211798
AA Change: K423*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 2678408
PHENOTYPE: Homozygous disruption of this locus results in fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(86) : Targeted(2) Gene trapped(84)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Coq8b T A 7: 27,250,625 Y376* probably null Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cttn T C 7: 144,461,268 T68A probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Kcnt2 A C 1: 140,509,496 T556P probably damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Med23 A G 10: 24,907,221 D734G probably damaging Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Naip1 C T 13: 100,444,735 M1I probably null Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pde8b T C 13: 95,042,040 K524R probably damaging Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Plekhg4 A T 8: 105,378,910 Q669L possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc26a5 A C 5: 21,823,563 F336V probably damaging Het
Slc5a6 T C 5: 31,040,770 T254A probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tcf25 T A 8: 123,381,504 H99Q probably benign Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Zfp143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Zfp143 APN 7 110091772 missense probably damaging 0.99
IGL01610:Zfp143 APN 7 110074126 nonsense probably null
IGL01678:Zfp143 APN 7 110080351 splice site probably benign
IGL01734:Zfp143 APN 7 110072209 splice site probably benign
IGL02505:Zfp143 APN 7 110091786 missense possibly damaging 0.54
IGL02577:Zfp143 APN 7 110091907 missense probably damaging 1.00
IGL03084:Zfp143 APN 7 110069611 splice site probably benign
H8786:Zfp143 UTSW 7 110094368 missense probably damaging 1.00
P0015:Zfp143 UTSW 7 110086111 critical splice acceptor site probably null
R0324:Zfp143 UTSW 7 110077147 missense possibly damaging 0.94
R0445:Zfp143 UTSW 7 110061117 unclassified probably benign
R0668:Zfp143 UTSW 7 110061274 unclassified probably benign
R1178:Zfp143 UTSW 7 110075721 splice site probably benign
R1587:Zfp143 UTSW 7 110074068 missense probably benign 0.06
R1992:Zfp143 UTSW 7 110061282 unclassified probably benign
R2110:Zfp143 UTSW 7 110086246 missense probably damaging 1.00
R2364:Zfp143 UTSW 7 110083242 missense probably damaging 0.97
R2417:Zfp143 UTSW 7 110069596 missense possibly damaging 0.73
R2899:Zfp143 UTSW 7 110072129 missense probably damaging 1.00
R3923:Zfp143 UTSW 7 110074191 missense probably damaging 1.00
R4117:Zfp143 UTSW 7 110091913 missense probably damaging 0.97
R4804:Zfp143 UTSW 7 110088769 missense probably damaging 1.00
R5048:Zfp143 UTSW 7 110074118 missense probably damaging 0.99
R5097:Zfp143 UTSW 7 110088791 missense probably damaging 1.00
R5239:Zfp143 UTSW 7 110094352 missense probably damaging 1.00
R5541:Zfp143 UTSW 7 110070480 missense probably benign 0.02
R5543:Zfp143 UTSW 7 110083315 nonsense probably null
R5630:Zfp143 UTSW 7 110088773 missense probably damaging 1.00
R6334:Zfp143 UTSW 7 110086131 missense probably damaging 1.00
R6736:Zfp143 UTSW 7 110091814 missense probably damaging 1.00
R7201:Zfp143 UTSW 7 110093080 missense possibly damaging 0.74
R7448:Zfp143 UTSW 7 110070498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGGAGTAACTTTGTCTAC -3'
(R):5'- CACTGGTGTCTTTCTGCAGC -3'

Sequencing Primer
(F):5'- CTGTGGAGTAACTTTGTCTACCTATG -3'
(R):5'- GCAGCACTTGTCATGACTATAC -3'
Posted On2016-12-15