Incidental Mutation 'R5806:Plekhg4'
ID448515
Institutional Source Beutler Lab
Gene Symbol Plekhg4
Ensembl Gene ENSMUSG00000014782
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms4931414L13Rik
MMRRC Submission 043392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105373274-105382862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105378910 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 669 (Q669L)
Ref Sequence ENSEMBL: ENSMUSP00000150574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000160650] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014927
AA Change: Q633L

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782
AA Change: Q633L

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000160191
AA Change: Q564L

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782
AA Change: Q564L

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161672
Predicted Effect probably benign
Transcript: ENSMUST00000167294
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168196
Predicted Effect possibly damaging
Transcript: ENSMUST00000214056
AA Change: Q669L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can function as a guanine nucleotide exchange factor (GEF) and may play a role in intracellular signaling and cytoskeleton dynamics at the Golgi apparatus. Polymorphisms in the region of this gene have been found to be associated with spinocerebellar ataxia in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Coq8b T A 7: 27,250,625 Y376* probably null Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cttn T C 7: 144,461,268 T68A probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Kcnt2 A C 1: 140,509,496 T556P probably damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Med23 A G 10: 24,907,221 D734G probably damaging Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Naip1 C T 13: 100,444,735 M1I probably null Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pde8b T C 13: 95,042,040 K524R probably damaging Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc26a5 A C 5: 21,823,563 F336V probably damaging Het
Slc5a6 T C 5: 31,040,770 T254A probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tcf25 T A 8: 123,381,504 H99Q probably benign Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp143 A T 7: 110,086,235 K423* probably null Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Plekhg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Plekhg4 APN 8 105375738 missense probably benign 0.01
IGL00970:Plekhg4 APN 8 105378435 missense probably benign 0.02
IGL01784:Plekhg4 APN 8 105378957 missense probably damaging 1.00
IGL02063:Plekhg4 APN 8 105379252 splice site probably benign
IGL02371:Plekhg4 APN 8 105379059 unclassified probably null
IGL02984:Plekhg4 UTSW 8 105380388 missense probably damaging 1.00
R0013:Plekhg4 UTSW 8 105375396 nonsense probably null
R0105:Plekhg4 UTSW 8 105382012 missense possibly damaging 0.65
R0105:Plekhg4 UTSW 8 105382012 missense possibly damaging 0.65
R0631:Plekhg4 UTSW 8 105379302 missense probably damaging 1.00
R1078:Plekhg4 UTSW 8 105381677 nonsense probably null
R1201:Plekhg4 UTSW 8 105381673 missense probably damaging 1.00
R1222:Plekhg4 UTSW 8 105379110 missense probably benign 0.03
R1418:Plekhg4 UTSW 8 105379110 missense probably benign 0.03
R1459:Plekhg4 UTSW 8 105381799 missense probably damaging 0.98
R1465:Plekhg4 UTSW 8 105381040 splice site probably benign
R1558:Plekhg4 UTSW 8 105381835 missense possibly damaging 0.73
R1637:Plekhg4 UTSW 8 105381781 missense probably benign 0.08
R1757:Plekhg4 UTSW 8 105381661 missense probably damaging 0.99
R1922:Plekhg4 UTSW 8 105378385 missense probably damaging 1.00
R1961:Plekhg4 UTSW 8 105381464 missense probably damaging 0.99
R2074:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2113:Plekhg4 UTSW 8 105379434 missense probably damaging 1.00
R2124:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2196:Plekhg4 UTSW 8 105376452 small deletion probably benign
R2321:Plekhg4 UTSW 8 105377540 missense probably benign 0.00
R2432:Plekhg4 UTSW 8 105381836 missense probably benign 0.00
R2908:Plekhg4 UTSW 8 105380861 missense probably damaging 1.00
R2910:Plekhg4 UTSW 8 105376452 small deletion probably benign
R4179:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R4180:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R4513:Plekhg4 UTSW 8 105380402 missense probably damaging 1.00
R4678:Plekhg4 UTSW 8 105380371 nonsense probably null
R4946:Plekhg4 UTSW 8 105381996 missense probably null 0.01
R5223:Plekhg4 UTSW 8 105378949 missense probably benign 0.18
R5362:Plekhg4 UTSW 8 105381398 missense possibly damaging 0.93
R5454:Plekhg4 UTSW 8 105376113 critical splice donor site probably null
R5609:Plekhg4 UTSW 8 105379502 critical splice donor site probably null
R5624:Plekhg4 UTSW 8 105380750 missense probably damaging 0.99
R6297:Plekhg4 UTSW 8 105377840 missense probably damaging 1.00
R7198:Plekhg4 UTSW 8 105378697 missense probably damaging 1.00
R7443:Plekhg4 UTSW 8 105380867 missense probably damaging 1.00
R7570:Plekhg4 UTSW 8 105378684 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGGGTCCCACTTTTATGTC -3'
(R):5'- TAACAATGGCTGCACAGTGG -3'

Sequencing Primer
(F):5'- GCTACTGACAGAGCTGGAGC -3'
(R):5'- GGCCACGACTGGAAACATCTTG -3'
Posted On2016-12-15