Incidental Mutation 'R5806:Naip1'
ID448540
Institutional Source Beutler Lab
Gene Symbol Naip1
Ensembl Gene ENSMUSG00000021640
Gene NameNLR family, apoptosis inhibitory protein 1
SynonymsBirc1a, D13Lsd1, Naip
MMRRC Submission 043392-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5806 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100407764-100452869 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) C to T at 100444735 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000152253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022142] [ENSMUST00000221727] [ENSMUST00000221943] [ENSMUST00000222155]
Predicted Effect probably null
Transcript: ENSMUST00000022142
AA Change: M1I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022142
Gene: ENSMUSG00000021640
AA Change: M1I

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.18e-20 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 7.82e-26 SMART
AAA 462 603 1.14e-2 SMART
low complexity region 908 919 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000221727
AA Change: M1I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably null
Transcript: ENSMUST00000221943
AA Change: M1I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably null
Transcript: ENSMUST00000222155
AA Change: M1I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,240,872 M216T probably benign Het
Abhd4 A G 14: 54,261,690 N36D probably benign Het
Ankra2 T C 13: 98,268,497 probably null Het
Btd A G 14: 31,667,512 T397A probably benign Het
Ccbe1 T A 18: 66,076,355 K205* probably null Het
Clspn A G 4: 126,586,106 K1081E probably damaging Het
Cmya5 A G 13: 93,093,937 S1548P possibly damaging Het
Coq8b T A 7: 27,250,625 Y376* probably null Het
Cpxm1 C A 2: 130,397,473 A12S probably damaging Het
Cttn T C 7: 144,461,268 T68A probably damaging Het
Cyp2a12 T A 7: 27,029,079 probably null Het
Ddx46 A G 13: 55,663,337 Q582R possibly damaging Het
Ddx55 A G 5: 124,559,199 E208G probably damaging Het
Dync1h1 A T 12: 110,651,653 T3209S probably damaging Het
Dyx1c1 T C 9: 72,962,054 L182P probably benign Het
Ep400 A T 5: 110,755,554 L393* probably null Het
Ern1 G C 11: 106,398,705 S924C probably damaging Het
Fanci T C 7: 79,448,848 I1249T probably damaging Het
Fgfbp3 T G 19: 36,918,549 D223A probably damaging Het
Frmd6 T C 12: 70,890,020 L313P probably damaging Het
Galnt17 A G 5: 130,877,819 Y504H probably damaging Het
Gjb5 A G 4: 127,355,925 I142T probably benign Het
Gvin1 T C 7: 106,158,206 D2352G probably benign Het
H2-M2 G A 17: 37,481,726 T218I probably damaging Het
Hal A G 10: 93,490,984 T161A probably damaging Het
Helb G A 10: 120,092,519 R806C probably damaging Het
Ift80 T A 3: 68,950,476 I279F probably benign Het
Itln1 A T 1: 171,531,152 I149N possibly damaging Het
Kcnt2 A C 1: 140,509,496 T556P probably damaging Het
Klk1b22 A T 7: 44,115,877 E84D possibly damaging Het
Krt78 A G 15: 101,950,502 L305P probably damaging Het
Lzts2 T C 19: 45,026,367 probably benign Het
Macf1 A G 4: 123,371,887 L6843P probably damaging Het
Magi2 C A 5: 20,651,204 H841Q probably benign Het
Mdm1 A T 10: 118,166,658 H628L probably benign Het
Med23 A G 10: 24,907,221 D734G probably damaging Het
Mfsd13a T C 19: 46,366,410 W9R probably benign Het
Mki67 T C 7: 135,704,605 H576R probably damaging Het
Muc5b A G 7: 141,862,835 T3173A possibly damaging Het
Mx1 A T 16: 97,454,151 V234E possibly damaging Het
Myh2 T C 11: 67,181,315 L623P probably damaging Het
Ncapd2 A T 6: 125,181,154 V337E probably damaging Het
Nit2 G A 16: 57,161,693 T64M possibly damaging Het
Olfr1195 T C 2: 88,683,151 N194D probably damaging Het
Olfr394 A T 11: 73,887,547 M275K probably damaging Het
Olfr49 A T 14: 54,282,807 F29L probably benign Het
Otub2 A G 12: 103,403,397 E245G probably benign Het
Pde8b T C 13: 95,042,040 K524R probably damaging Het
Pih1d2 C T 9: 50,618,450 probably benign Het
Pik3cg T A 12: 32,204,953 D345V possibly damaging Het
Plekhg4 A T 8: 105,378,910 Q669L possibly damaging Het
Prlr A T 15: 10,319,204 Y73F probably damaging Het
Ptk6 T C 2: 181,199,730 I129V possibly damaging Het
Ranbp3 A T 17: 56,710,717 T458S probably benign Het
Ren1 T A 1: 133,355,511 Y128* probably null Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rnf222 T C 11: 68,892,963 S119P possibly damaging Het
Rrbp1 T A 2: 143,963,331 E1007V probably benign Het
Sept11 G A 5: 93,167,578 E389K probably benign Het
Setbp1 A G 18: 78,856,482 probably null Het
Slc25a54 T C 3: 109,080,578 S12P probably benign Het
Slc26a5 A C 5: 21,823,563 F336V probably damaging Het
Slc5a6 T C 5: 31,040,770 T254A probably damaging Het
Smcr8 G T 11: 60,780,382 probably null Het
Srcap A T 7: 127,559,163 probably benign Het
Srrt A T 5: 137,297,917 I509N probably damaging Het
Tcf25 T A 8: 123,381,504 H99Q probably benign Het
Tmem40 A G 6: 115,736,412 V76A probably benign Het
Tnni3k A T 3: 154,827,611 S740T possibly damaging Het
Top3a A G 11: 60,776,920 probably null Het
Tpd52l2 C A 2: 181,502,887 T109K probably damaging Het
Tsnaxip1 C A 8: 105,837,496 D109E possibly damaging Het
Uty G T Y: 1,170,921 D313E probably damaging Het
Zfp143 A T 7: 110,086,235 K423* probably null Het
Zfp407 C T 18: 84,558,614 G1458D probably damaging Het
Other mutations in Naip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Naip1 APN 13 100443720 critical splice acceptor site probably null
IGL01145:Naip1 APN 13 100409121 missense probably benign 0.00
IGL01356:Naip1 APN 13 100423214 missense probably damaging 0.99
IGL01414:Naip1 APN 13 100409173 critical splice acceptor site probably null
IGL01505:Naip1 APN 13 100425933 missense probably damaging 1.00
IGL01573:Naip1 APN 13 100427382 missense probably benign 0.03
IGL01931:Naip1 APN 13 100409032 nonsense probably null
IGL02043:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02097:Naip1 APN 13 100425588 missense probably benign 0.03
IGL02331:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02627:Naip1 APN 13 100425648 missense possibly damaging 0.68
IGL02675:Naip1 APN 13 100409118 missense probably benign
IGL02801:Naip1 APN 13 100444368 missense probably damaging 1.00
IGL02851:Naip1 APN 13 100433262 missense probably damaging 1.00
IGL03038:Naip1 APN 13 100437333 nonsense probably null
IGL03399:Naip1 APN 13 100408918 missense probably damaging 1.00
FR4340:Naip1 UTSW 13 100423076 missense probably benign
FR4342:Naip1 UTSW 13 100425471 missense probably benign 0.00
R0051:Naip1 UTSW 13 100411001 missense probably damaging 0.96
R0095:Naip1 UTSW 13 100423083 missense probably benign 0.24
R0147:Naip1 UTSW 13 100426910 missense possibly damaging 0.67
R0375:Naip1 UTSW 13 100409148 missense probably benign 0.21
R0442:Naip1 UTSW 13 100444516 missense probably benign 0.00
R0455:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0491:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0614:Naip1 UTSW 13 100444200 missense probably benign 0.00
R0785:Naip1 UTSW 13 100423076 missense probably benign
R0785:Naip1 UTSW 13 100423085 missense probably benign 0.00
R0787:Naip1 UTSW 13 100426096 missense probably benign 0.22
R1081:Naip1 UTSW 13 100423070 missense probably benign 0.21
R1177:Naip1 UTSW 13 100427064 missense possibly damaging 0.91
R1476:Naip1 UTSW 13 100426870 missense probably benign 0.35
R1672:Naip1 UTSW 13 100423149 missense probably benign 0.00
R1809:Naip1 UTSW 13 100426239 missense probably benign
R2057:Naip1 UTSW 13 100425573 missense probably damaging 0.96
R2182:Naip1 UTSW 13 100413680 missense probably benign 0.01
R2395:Naip1 UTSW 13 100423106 missense possibly damaging 0.83
R2518:Naip1 UTSW 13 100423219 missense probably benign 0.00
R3033:Naip1 UTSW 13 100432458 missense probably benign 0.01
R3122:Naip1 UTSW 13 100408995 missense probably damaging 1.00
R3439:Naip1 UTSW 13 100423219 missense probably benign 0.00
R4167:Naip1 UTSW 13 100444286 missense probably benign 0.04
R4179:Naip1 UTSW 13 100426176 missense probably damaging 0.99
R4212:Naip1 UTSW 13 100426875 utr 3 prime probably null
R4639:Naip1 UTSW 13 100444283 missense probably benign 0.31
R4674:Naip1 UTSW 13 100444174 missense probably damaging 1.00
R4736:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4740:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4778:Naip1 UTSW 13 100426648 missense probably damaging 1.00
R4806:Naip1 UTSW 13 100425621 missense probably benign 0.00
R4855:Naip1 UTSW 13 100423220 unclassified probably null
R5740:Naip1 UTSW 13 100432501 critical splice acceptor site probably null
R5797:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R5895:Naip1 UTSW 13 100423128 missense probably benign 0.00
R5896:Naip1 UTSW 13 100423128 missense probably benign 0.00
R6023:Naip1 UTSW 13 100426186 missense probably benign 0.00
R6109:Naip1 UTSW 13 100427182 missense probably damaging 1.00
R6117:Naip1 UTSW 13 100444737 start codon destroyed probably damaging 0.99
R6133:Naip1 UTSW 13 100444643 missense probably benign 0.10
R6241:Naip1 UTSW 13 100425661 missense probably damaging 0.99
R6335:Naip1 UTSW 13 100426552 missense probably damaging 1.00
R6404:Naip1 UTSW 13 100423219 missense probably benign 0.00
R6475:Naip1 UTSW 13 100409088 missense probably damaging 1.00
R6508:Naip1 UTSW 13 100436465 missense probably damaging 1.00
R6580:Naip1 UTSW 13 100444649 missense probably damaging 0.99
R6600:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6600:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6603:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6603:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6633:Naip1 UTSW 13 100423076 missense probably benign
R6633:Naip1 UTSW 13 100423085 missense probably benign 0.00
R6720:Naip1 UTSW 13 100423077 missense probably benign 0.00
R6805:Naip1 UTSW 13 100427341 missense probably benign 0.04
R7043:Naip1 UTSW 13 100426914 missense probably damaging 1.00
R7615:Naip1 UTSW 13 100425776 missense probably benign 0.00
X0066:Naip1 UTSW 13 100437322 missense probably damaging 1.00
Y4335:Naip1 UTSW 13 100425522 missense probably benign 0.00
Y4336:Naip1 UTSW 13 100425522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTGGCTTCACTGCGCATC -3'
(R):5'- TCGAGTCAGAACATGAAACCCG -3'

Sequencing Primer
(F):5'- CTGCGCATCTGTGAGTTAAAACC -3'
(R):5'- CATGAGTGTGTCCATGTAGTAGTCAG -3'
Posted On2016-12-15