Incidental Mutation 'R5807:Prim2'
ID448556
Institutional Source Beutler Lab
Gene Symbol Prim2
Ensembl Gene ENSMUSG00000026134
Gene NameDNA primase, p58 subunit
Synonyms
MMRRC Submission 043393-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R5807 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location33453810-33669795 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 33480406 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027312]
Predicted Effect probably benign
Transcript: ENSMUST00000027312
SMART Domains Protein: ENSMUSP00000027312
Gene: ENSMUSG00000026134

DomainStartEndE-ValueType
Pfam:DNA_primase_lrg 182 448 6.2e-99 PFAM
low complexity region 482 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189552
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 58 kilodalton subunit of DNA primase, an enzyme that plays a key role in the replication of DNA. The encoded protein forms a heterodimer with a 49 kilodalton subunit. This heterodimer functions as a DNA-directed RNA polymerase to synthesize small RNA primers that are used to create Okazaki fragments on the lagging strand of the DNA. Alternative splicing of this gene results in multiple transcript variants. This gene has a related pseudogene, which is also present on chromosome 6. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,303,492 L943P probably damaging Het
Abcg5 C A 17: 84,672,291 V214F probably damaging Het
Ang T A 14: 51,101,429 probably benign Het
Arfgef3 A G 10: 18,647,798 probably null Het
Arhgef4 A G 1: 34,807,615 probably benign Het
Atp11b T C 3: 35,812,279 I409T probably damaging Het
Atp5b G A 10: 128,088,562 probably benign Het
Atp9a G A 2: 168,653,534 A660V probably damaging Het
Avpr1a A G 10: 122,449,471 T223A probably benign Het
Bmp2k T C 5: 97,063,494 M507T unknown Het
Cep295 A G 9: 15,332,532 S287P probably damaging Het
Chrna7 T A 7: 63,148,601 D111V probably damaging Het
Cnr2 A G 4: 135,917,436 D275G probably benign Het
Col28a1 T A 6: 8,158,144 M305L probably benign Het
Cpb1 T A 3: 20,263,742 D206V probably damaging Het
Cyp2c50 T C 19: 40,113,500 L453S probably damaging Het
Ddx52 T G 11: 83,949,682 S284A probably benign Het
Efcab1 A T 16: 14,916,972 I69F probably benign Het
Eif2ak4 G T 2: 118,388,851 R48L probably benign Het
Esrrb A G 12: 86,514,401 E303G possibly damaging Het
Fbxo21 A G 5: 117,976,868 E23G probably benign Het
Fcamr T C 1: 130,811,526 S188P probably damaging Het
Fer1l6 C A 15: 58,590,550 S818* probably null Het
Fn1 T C 1: 71,648,059 D213G probably damaging Het
Gcg A G 2: 62,475,725 I176T possibly damaging Het
Glis1 T A 4: 107,568,082 S109T probably benign Het
Gm266 T C 12: 111,485,739 D11G probably benign Het
Gm5070 C A 3: 95,410,654 noncoding transcript Het
Gm8444 T C 15: 81,843,453 probably benign Het
Gm8989 T A 7: 106,330,223 noncoding transcript Het
Golga4 A G 9: 118,527,130 T117A probably damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc2 T A 7: 56,230,919 F4766L probably damaging Het
Inhbc C A 10: 127,357,542 E202* probably null Het
Kcnu1 C T 8: 25,849,714 T20I possibly damaging Het
Klhdc3 T C 17: 46,677,465 D161G probably damaging Het
Krt84 T A 15: 101,530,212 K280M probably damaging Het
Krtap9-5 T A 11: 99,949,069 C199S unknown Het
Mrgprb3 A G 7: 48,643,362 V147A probably benign Het
Ndufs6 A T 13: 73,327,434 F48L probably damaging Het
Obscn T C 11: 59,079,650 S2586G probably damaging Het
Olfr148 A G 9: 39,614,463 R299G probably benign Het
Olfr156 C A 4: 43,820,912 V150L probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Osbpl6 A G 2: 76,584,513 D416G probably damaging Het
Pdilt A G 7: 119,500,543 probably benign Het
Phf12 C A 11: 78,022,426 D401E probably benign Het
Pla2r1 C T 2: 60,428,721 V1108M possibly damaging Het
Ptpn6 T C 6: 124,724,984 H406R probably benign Het
Qpctl G T 7: 19,143,207 H329N probably damaging Het
Ripk3 T A 14: 55,785,298 N390Y probably damaging Het
Rnase1 A G 14: 51,145,450 V149A probably benign Het
Rtn3 T A 19: 7,456,827 D581V probably damaging Het
Slamf1 A G 1: 171,775,062 Y119C probably damaging Het
Slc25a34 A G 4: 141,623,662 M12T probably benign Het
Tmem38a A G 8: 72,580,100 Y141C probably damaging Het
Tnr C T 1: 159,886,930 T793I possibly damaging Het
Tns3 T C 11: 8,493,211 D384G probably damaging Het
Vmn2r116 T A 17: 23,387,307 Y398N probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Other mutations in Prim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Prim2 APN 1 33512160 missense probably damaging 1.00
IGL02576:Prim2 APN 1 33484717 missense probably damaging 1.00
R0398:Prim2 UTSW 1 33484676 splice site probably benign
R0686:Prim2 UTSW 1 33514189 missense probably benign
R1452:Prim2 UTSW 1 33630404 missense probably benign
R3925:Prim2 UTSW 1 33533299 missense probably damaging 1.00
R4398:Prim2 UTSW 1 33512111 missense probably damaging 1.00
R4831:Prim2 UTSW 1 33670136 unclassified probably benign
R4832:Prim2 UTSW 1 33464064 missense probably benign
R5057:Prim2 UTSW 1 33630360 nonsense probably null
R5240:Prim2 UTSW 1 33480316 intron probably benign
R5294:Prim2 UTSW 1 33668893 missense probably benign 0.11
R5771:Prim2 UTSW 1 33454151 missense unknown
R6307:Prim2 UTSW 1 33662292 missense probably benign 0.00
R7165:Prim2 UTSW 1 33628393 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCTCAGCTGATAGAAAAGC -3'
(R):5'- AATAACCTGGTTGTCCTGCGG -3'

Sequencing Primer
(F):5'- GGGATTGCTGTGCTCCTTTACC -3'
(R):5'- TCCTGCGGCTTGTGTTC -3'
Posted On2016-12-15