Incidental Mutation 'R5807:Atp11b'
ID448571
Institutional Source Beutler Lab
Gene Symbol Atp11b
Ensembl Gene ENSMUSG00000037400
Gene NameATPase, class VI, type 11B
Synonyms1110019I14Rik
MMRRC Submission 043393-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R5807 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location35754106-35856276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35812279 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 409 (I409T)
Ref Sequence ENSEMBL: ENSMUSP00000142676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029257] [ENSMUST00000198599]
Predicted Effect probably damaging
Transcript: ENSMUST00000029257
AA Change: I609T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400
AA Change: I609T

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196965
Predicted Effect probably damaging
Transcript: ENSMUST00000198599
AA Change: I409T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142676
Gene: ENSMUSG00000037400
AA Change: I409T

DomainStartEndE-ValueType
low complexity region 90 107 N/A INTRINSIC
Pfam:Hydrolase 201 632 3e-17 PFAM
Pfam:HAD 204 629 4e-16 PFAM
Pfam:Hydrolase_like2 292 405 1.2e-13 PFAM
low complexity region 833 848 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200445
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,303,492 L943P probably damaging Het
Abcg5 C A 17: 84,672,291 V214F probably damaging Het
Ang T A 14: 51,101,429 probably benign Het
Arfgef3 A G 10: 18,647,798 probably null Het
Arhgef4 A G 1: 34,807,615 probably benign Het
Atp5b G A 10: 128,088,562 probably benign Het
Atp9a G A 2: 168,653,534 A660V probably damaging Het
Avpr1a A G 10: 122,449,471 T223A probably benign Het
Bmp2k T C 5: 97,063,494 M507T unknown Het
Cep295 A G 9: 15,332,532 S287P probably damaging Het
Chrna7 T A 7: 63,148,601 D111V probably damaging Het
Cnr2 A G 4: 135,917,436 D275G probably benign Het
Col28a1 T A 6: 8,158,144 M305L probably benign Het
Cpb1 T A 3: 20,263,742 D206V probably damaging Het
Cyp2c50 T C 19: 40,113,500 L453S probably damaging Het
Ddx52 T G 11: 83,949,682 S284A probably benign Het
Efcab1 A T 16: 14,916,972 I69F probably benign Het
Eif2ak4 G T 2: 118,388,851 R48L probably benign Het
Esrrb A G 12: 86,514,401 E303G possibly damaging Het
Fbxo21 A G 5: 117,976,868 E23G probably benign Het
Fcamr T C 1: 130,811,526 S188P probably damaging Het
Fer1l6 C A 15: 58,590,550 S818* probably null Het
Fn1 T C 1: 71,648,059 D213G probably damaging Het
Gcg A G 2: 62,475,725 I176T possibly damaging Het
Glis1 T A 4: 107,568,082 S109T probably benign Het
Gm266 T C 12: 111,485,739 D11G probably benign Het
Gm5070 C A 3: 95,410,654 noncoding transcript Het
Gm8444 T C 15: 81,843,453 probably benign Het
Gm8989 T A 7: 106,330,223 noncoding transcript Het
Golga4 A G 9: 118,527,130 T117A probably damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc2 T A 7: 56,230,919 F4766L probably damaging Het
Inhbc C A 10: 127,357,542 E202* probably null Het
Kcnu1 C T 8: 25,849,714 T20I possibly damaging Het
Klhdc3 T C 17: 46,677,465 D161G probably damaging Het
Krt84 T A 15: 101,530,212 K280M probably damaging Het
Krtap9-5 T A 11: 99,949,069 C199S unknown Het
Mrgprb3 A G 7: 48,643,362 V147A probably benign Het
Ndufs6 A T 13: 73,327,434 F48L probably damaging Het
Obscn T C 11: 59,079,650 S2586G probably damaging Het
Olfr148 A G 9: 39,614,463 R299G probably benign Het
Olfr156 C A 4: 43,820,912 V150L probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Osbpl6 A G 2: 76,584,513 D416G probably damaging Het
Pdilt A G 7: 119,500,543 probably benign Het
Phf12 C A 11: 78,022,426 D401E probably benign Het
Pla2r1 C T 2: 60,428,721 V1108M possibly damaging Het
Prim2 A G 1: 33,480,406 probably benign Het
Ptpn6 T C 6: 124,724,984 H406R probably benign Het
Qpctl G T 7: 19,143,207 H329N probably damaging Het
Ripk3 T A 14: 55,785,298 N390Y probably damaging Het
Rnase1 A G 14: 51,145,450 V149A probably benign Het
Rtn3 T A 19: 7,456,827 D581V probably damaging Het
Slamf1 A G 1: 171,775,062 Y119C probably damaging Het
Slc25a34 A G 4: 141,623,662 M12T probably benign Het
Tmem38a A G 8: 72,580,100 Y141C probably damaging Het
Tnr C T 1: 159,886,930 T793I possibly damaging Het
Tns3 T C 11: 8,493,211 D384G probably damaging Het
Vmn2r116 T A 17: 23,387,307 Y398N probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Other mutations in Atp11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp11b APN 3 35809376 unclassified probably null
IGL00722:Atp11b APN 3 35819935 missense probably damaging 1.00
IGL00725:Atp11b APN 3 35827073 missense probably damaging 0.97
IGL01514:Atp11b APN 3 35836981 missense probably damaging 1.00
IGL01532:Atp11b APN 3 35849502 nonsense probably null
IGL01789:Atp11b APN 3 35789592 missense possibly damaging 0.81
IGL01915:Atp11b APN 3 35831463 missense probably damaging 1.00
IGL02009:Atp11b APN 3 35814152 missense probably benign 0.07
IGL02049:Atp11b APN 3 35800493 missense probably damaging 0.99
IGL02952:Atp11b APN 3 35828695 missense probably damaging 1.00
IGL02991:Atp11b UTSW 3 35826991 missense probably benign 0.00
R0044:Atp11b UTSW 3 35812252 missense probably damaging 0.99
R0254:Atp11b UTSW 3 35812110 missense possibly damaging 0.82
R0538:Atp11b UTSW 3 35837014 missense probably damaging 1.00
R0541:Atp11b UTSW 3 35806944 missense probably damaging 0.99
R0653:Atp11b UTSW 3 35839194 missense probably damaging 0.99
R0790:Atp11b UTSW 3 35832923 missense probably damaging 1.00
R1083:Atp11b UTSW 3 35778013 splice site probably benign
R1371:Atp11b UTSW 3 35806769 missense probably damaging 0.97
R1458:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R1875:Atp11b UTSW 3 35839147 missense probably damaging 1.00
R1921:Atp11b UTSW 3 35834325 missense probably damaging 1.00
R2008:Atp11b UTSW 3 35855122 missense probably damaging 0.97
R2065:Atp11b UTSW 3 35839074 missense probably damaging 1.00
R2112:Atp11b UTSW 3 35837528 missense probably damaging 1.00
R2228:Atp11b UTSW 3 35806942 missense probably damaging 1.00
R2270:Atp11b UTSW 3 35810134 unclassified probably null
R2273:Atp11b UTSW 3 35828613 missense probably benign 0.04
R2439:Atp11b UTSW 3 35814084 missense possibly damaging 0.68
R2497:Atp11b UTSW 3 35855145 missense probably damaging 0.99
R4181:Atp11b UTSW 3 35789558 missense probably damaging 1.00
R4181:Atp11b UTSW 3 35800565 missense probably benign 0.19
R4714:Atp11b UTSW 3 35834394 missense probably benign 0.02
R4923:Atp11b UTSW 3 35835379 critical splice donor site probably null
R4937:Atp11b UTSW 3 35807008 unclassified probably null
R5013:Atp11b UTSW 3 35834383 missense possibly damaging 0.66
R5058:Atp11b UTSW 3 35809361 missense probably benign 0.41
R5171:Atp11b UTSW 3 35832937 missense probably damaging 1.00
R5200:Atp11b UTSW 3 35837007 missense probably benign 0.21
R5465:Atp11b UTSW 3 35810184 missense probably benign 0.00
R5651:Atp11b UTSW 3 35855140 missense probably damaging 1.00
R5689:Atp11b UTSW 3 35834352 missense possibly damaging 0.67
R5718:Atp11b UTSW 3 35837516 missense probably benign 0.12
R5888:Atp11b UTSW 3 35837547 missense probably benign 0.15
R6059:Atp11b UTSW 3 35814177 missense possibly damaging 0.72
R6259:Atp11b UTSW 3 35806901 missense probably damaging 1.00
R6359:Atp11b UTSW 3 35778061 missense probably benign 0.04
R6367:Atp11b UTSW 3 35784537 missense probably damaging 1.00
R6577:Atp11b UTSW 3 35839162 missense probably damaging 0.99
R6818:Atp11b UTSW 3 35814180 missense possibly damaging 0.71
R7016:Atp11b UTSW 3 35841036 missense probably benign
R7178:Atp11b UTSW 3 35819950 missense probably benign 0.34
R7614:Atp11b UTSW 3 35810110 splice site probably null
R7729:Atp11b UTSW 3 35778107 missense probably damaging 0.97
R7910:Atp11b UTSW 3 35831503 missense possibly damaging 0.68
R7991:Atp11b UTSW 3 35831503 missense possibly damaging 0.68
R8085:Atp11b UTSW 3 35841036 missense probably benign
R8095:Atp11b UTSW 3 35834416 missense probably damaging 1.00
Z1088:Atp11b UTSW 3 35812213 missense probably damaging 1.00
Z1177:Atp11b UTSW 3 35806854 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGAGAATGAGTGTAATTGTTCAGGC -3'
(R):5'- CCCTACTAGAACAGGGTGGAAG -3'

Sequencing Primer
(F):5'- AATTGTTCAGGCACCTTCAGG -3'
(R):5'- CTAGAAAGATGAAACCTCAATC -3'
Posted On2016-12-15