Incidental Mutation 'R5807:Bmp2k'
ID448576
Institutional Source Beutler Lab
Gene Symbol Bmp2k
Ensembl Gene ENSMUSG00000034663
Gene NameBMP2 inducible kinase
Synonyms4933417M22Rik, BIKE
MMRRC Submission 043393-MU
Accession Numbers

Genbank: NM_080708; MGI: 2155456

Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R5807 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location96997689-97091867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97063494 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 507 (M507T)
Ref Sequence ENSEMBL: ENSMUSP00000108598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035635] [ENSMUST00000112974]
Predicted Effect unknown
Transcript: ENSMUST00000035635
AA Change: M507T
SMART Domains Protein: ENSMUSP00000037970
Gene: ENSMUSG00000034663
AA Change: M507T

DomainStartEndE-ValueType
low complexity region 12 37 N/A INTRINSIC
Pfam:Pkinase_Tyr 48 309 8.9e-27 PFAM
Pfam:Pkinase 48 311 1.6e-43 PFAM
coiled coil region 455 490 N/A INTRINSIC
low complexity region 511 538 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 838 852 N/A INTRINSIC
Pfam:BMP2K_C 873 1138 7.9e-94 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112974
AA Change: M507T
SMART Domains Protein: ENSMUSP00000108598
Gene: ENSMUSG00000034663
AA Change: M507T

DomainStartEndE-ValueType
low complexity region 12 37 N/A INTRINSIC
Pfam:Pkinase_Tyr 48 310 5.5e-28 PFAM
Pfam:Pkinase 48 313 5.2e-43 PFAM
Pfam:Kinase-like 128 302 1.2e-7 PFAM
coiled coil region 455 490 N/A INTRINSIC
low complexity region 511 538 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human homolog of mouse BMP-2-inducible kinase. Bone morphogenic proteins (BMPs) play a key role in skeletal development and patterning. Expression of the mouse gene is increased during BMP-2 induced differentiation and the gene product is a putative serine/threonine protein kinase containing a nuclear localization signal. Therefore, the protein encoded by this human homolog is thought to be a protein kinase with a putative regulatory role in attenuating the program of osteoblast differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,303,492 L943P probably damaging Het
Abcg5 C A 17: 84,672,291 V214F probably damaging Het
Ang T A 14: 51,101,429 probably benign Het
Arfgef3 A G 10: 18,647,798 probably null Het
Arhgef4 A G 1: 34,807,615 probably benign Het
Atp11b T C 3: 35,812,279 I409T probably damaging Het
Atp5b G A 10: 128,088,562 probably benign Het
Atp9a G A 2: 168,653,534 A660V probably damaging Het
Avpr1a A G 10: 122,449,471 T223A probably benign Het
Cep295 A G 9: 15,332,532 S287P probably damaging Het
Chrna7 T A 7: 63,148,601 D111V probably damaging Het
Cnr2 A G 4: 135,917,436 D275G probably benign Het
Col28a1 T A 6: 8,158,144 M305L probably benign Het
Cpb1 T A 3: 20,263,742 D206V probably damaging Het
Cyp2c50 T C 19: 40,113,500 L453S probably damaging Het
Ddx52 T G 11: 83,949,682 S284A probably benign Het
Efcab1 A T 16: 14,916,972 I69F probably benign Het
Eif2ak4 G T 2: 118,388,851 R48L probably benign Het
Esrrb A G 12: 86,514,401 E303G possibly damaging Het
Fbxo21 A G 5: 117,976,868 E23G probably benign Het
Fcamr T C 1: 130,811,526 S188P probably damaging Het
Fer1l6 C A 15: 58,590,550 S818* probably null Het
Fn1 T C 1: 71,648,059 D213G probably damaging Het
Gcg A G 2: 62,475,725 I176T possibly damaging Het
Glis1 T A 4: 107,568,082 S109T probably benign Het
Gm266 T C 12: 111,485,739 D11G probably benign Het
Gm5070 C A 3: 95,410,654 noncoding transcript Het
Gm8444 T C 15: 81,843,453 probably benign Het
Gm8989 T A 7: 106,330,223 noncoding transcript Het
Golga4 A G 9: 118,527,130 T117A probably damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc2 T A 7: 56,230,919 F4766L probably damaging Het
Inhbc C A 10: 127,357,542 E202* probably null Het
Kcnu1 C T 8: 25,849,714 T20I possibly damaging Het
Klhdc3 T C 17: 46,677,465 D161G probably damaging Het
Krt84 T A 15: 101,530,212 K280M probably damaging Het
Krtap9-5 T A 11: 99,949,069 C199S unknown Het
Mrgprb3 A G 7: 48,643,362 V147A probably benign Het
Ndufs6 A T 13: 73,327,434 F48L probably damaging Het
Obscn T C 11: 59,079,650 S2586G probably damaging Het
Olfr148 A G 9: 39,614,463 R299G probably benign Het
Olfr156 C A 4: 43,820,912 V150L probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Osbpl6 A G 2: 76,584,513 D416G probably damaging Het
Pdilt A G 7: 119,500,543 probably benign Het
Phf12 C A 11: 78,022,426 D401E probably benign Het
Pla2r1 C T 2: 60,428,721 V1108M possibly damaging Het
Prim2 A G 1: 33,480,406 probably benign Het
Ptpn6 T C 6: 124,724,984 H406R probably benign Het
Qpctl G T 7: 19,143,207 H329N probably damaging Het
Ripk3 T A 14: 55,785,298 N390Y probably damaging Het
Rnase1 A G 14: 51,145,450 V149A probably benign Het
Rtn3 T A 19: 7,456,827 D581V probably damaging Het
Slamf1 A G 1: 171,775,062 Y119C probably damaging Het
Slc25a34 A G 4: 141,623,662 M12T probably benign Het
Tmem38a A G 8: 72,580,100 Y141C probably damaging Het
Tnr C T 1: 159,886,930 T793I possibly damaging Het
Tns3 T C 11: 8,493,211 D384G probably damaging Het
Vmn2r116 T A 17: 23,387,307 Y398N probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Other mutations in Bmp2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Bmp2k APN 5 97063548 splice site probably null
IGL01408:Bmp2k APN 5 97086964 nonsense probably null
IGL02146:Bmp2k APN 5 97064830 missense unknown
IGL02232:Bmp2k APN 5 97031250 splice site probably benign
3-1:Bmp2k UTSW 5 97053120 missense possibly damaging 0.68
R0277:Bmp2k UTSW 5 97087823 utr 3 prime probably benign
R0284:Bmp2k UTSW 5 97068455 missense unknown
R0323:Bmp2k UTSW 5 97087823 utr 3 prime probably benign
R0384:Bmp2k UTSW 5 97031125 splice site probably benign
R0726:Bmp2k UTSW 5 97087494 utr 3 prime probably benign
R1479:Bmp2k UTSW 5 97053200 missense probably benign 0.16
R1686:Bmp2k UTSW 5 97063533 missense unknown
R1826:Bmp2k UTSW 5 97061402 splice site probably benign
R3842:Bmp2k UTSW 5 97087151 utr 3 prime probably benign
R3919:Bmp2k UTSW 5 97074740 missense unknown
R4649:Bmp2k UTSW 5 97053111 missense possibly damaging 0.95
R4954:Bmp2k UTSW 5 97086764 unclassified probably benign
R4975:Bmp2k UTSW 5 97087085 utr 3 prime probably benign
R5001:Bmp2k UTSW 5 97053142 missense probably damaging 1.00
R5122:Bmp2k UTSW 5 97087015 utr 3 prime probably benign
R5260:Bmp2k UTSW 5 97087351 utr 3 prime probably benign
R5516:Bmp2k UTSW 5 97087453 utr 3 prime probably benign
R5762:Bmp2k UTSW 5 97087191 frame shift probably null
R5835:Bmp2k UTSW 5 97056982 missense possibly damaging 0.95
R5928:Bmp2k UTSW 5 97087736 utr 3 prime probably benign
R6012:Bmp2k UTSW 5 97063608 intron probably null
R6546:Bmp2k UTSW 5 97088078 missense probably benign 0.32
R6664:Bmp2k UTSW 5 97088130 missense probably benign 0.03
R6962:Bmp2k UTSW 5 97031238 nonsense probably null
R7081:Bmp2k UTSW 5 97064961 missense unknown
R7267:Bmp2k UTSW 5 97068434 missense unknown
R7473:Bmp2k UTSW 5 97057012 missense probably benign 0.40
R7498:Bmp2k UTSW 5 97088119 missense probably benign 0.03
R7659:Bmp2k UTSW 5 97074719 missense unknown
X0026:Bmp2k UTSW 5 97038533 missense probably damaging 1.00
Z1177:Bmp2k UTSW 5 97053156 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACTGGAAGGCATGGATATTAGT -3'
(R):5'- CCCTCATTAAGTAACGTGAGCCAATC -3'

Sequencing Primer
(F):5'- TCATCATCACTGTGGGGAAC -3'
(R):5'- ATGCATGACACACTTGCTGG -3'
Posted On2016-12-15