Mutagenetix > Incidental Mutation

Incidental Mutation 'R5807:Cep295'

448591

Institutional Source

Beutler Lab

Gene Symbol

Cep295

Ensembl Gene

ENSMUSG00000046111

Gene Name

centrosomal protein 295

Synonyms

LOC382128, 5830418K08Rik

MMRRC Submission

043393-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R5807 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15316915-15357788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 15332532 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 287 (S287P)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000058041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000066038

Predicted Effect

probably benign
Transcript: ENSMUST00000098979
AA Change: S1543P

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: S1543P

Domain	Start	End	E-Value	Type
low complexity region	159	175	N/A	INTRINSIC
coiled coil region	258	288	N/A	INTRINSIC
coiled coil region	536	583	N/A	INTRINSIC
coiled coil region	861	889	N/A	INTRINSIC
internal_repeat_1	890	1104	6.8e-5	PROSPERO
internal_repeat_1	1277	1489	6.8e-5	PROSPERO
low complexity region	1537	1548	N/A	INTRINSIC
low complexity region	1611	1625	N/A	INTRINSIC
coiled coil region	1707	1736	N/A	INTRINSIC
low complexity region	2003	2018	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160946
AA Change: S287P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111
AA Change: S287P

Domain	Start	End	E-Value	Type
coiled coil region	92	119	N/A	INTRINSIC
low complexity region	282	293	N/A	INTRINSIC
low complexity region	356	370	N/A	INTRINSIC
coiled coil region	451	480	N/A	INTRINSIC
low complexity region	828	843	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161132
AA Change: S1543P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: S1543P

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
coiled coil region	1300	1327	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	2035	2050	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161795
AA Change: S1495P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: S1495P

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
internal_repeat_1	842	1056	7.14e-5	PROSPERO
internal_repeat_1	1229	1441	7.14e-5	PROSPERO
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	1955	1970	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162264

Meta Mutation Damage Score

0.0962

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (65/66)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	G	1: 71,303,492	L943P	probably damaging	Het
Abcg5	C	A	17: 84,672,291	V214F	probably damaging	Het
Ang	T	A	14: 51,101,429		probably benign	Het
Arfgef3	A	G	10: 18,647,798		probably null	Het
Arhgef4	A	G	1: 34,807,615		probably benign	Het
Atp11b	T	C	3: 35,812,279	I409T	probably damaging	Het
Atp5b	G	A	10: 128,088,562		probably benign	Het
Atp9a	G	A	2: 168,653,534	A660V	probably damaging	Het
Avpr1a	A	G	10: 122,449,471	T223A	probably benign	Het
Bmp2k	T	C	5: 97,063,494	M507T	unknown	Het
Chrna7	T	A	7: 63,148,601	D111V	probably damaging	Het
Cnr2	A	G	4: 135,917,436	D275G	probably benign	Het
Col28a1	T	A	6: 8,158,144	M305L	probably benign	Het
Cpb1	T	A	3: 20,263,742	D206V	probably damaging	Het
Cyp2c50	T	C	19: 40,113,500	L453S	probably damaging	Het
Ddx52	T	G	11: 83,949,682	S284A	probably benign	Het
Efcab1	A	T	16: 14,916,972	I69F	probably benign	Het
Eif2ak4	G	T	2: 118,388,851	R48L	probably benign	Het
Esrrb	A	G	12: 86,514,401	E303G	possibly damaging	Het
Fbxo21	A	G	5: 117,976,868	E23G	probably benign	Het
Fcamr	T	C	1: 130,811,526	S188P	probably damaging	Het
Fer1l6	C	A	15: 58,590,550	S818*	probably null	Het
Fn1	T	C	1: 71,648,059	D213G	probably damaging	Het
Gcg	A	G	2: 62,475,725	I176T	possibly damaging	Het
Glis1	T	A	4: 107,568,082	S109T	probably benign	Het
Gm266	T	C	12: 111,485,739	D11G	probably benign	Het
Gm5070	C	A	3: 95,410,654		noncoding transcript	Het
Gm8444	T	C	15: 81,843,453		probably benign	Het
Gm8989	T	A	7: 106,330,223		noncoding transcript	Het
Golga4	A	G	9: 118,527,130	T117A	probably damaging	Het
Gpr132	G	A	12: 112,852,796	R137C	probably damaging	Het
Herc2	T	A	7: 56,230,919	F4766L	probably damaging	Het
Inhbc	C	A	10: 127,357,542	E202*	probably null	Het
Kcnu1	C	T	8: 25,849,714	T20I	possibly damaging	Het
Klhdc3	T	C	17: 46,677,465	D161G	probably damaging	Het
Krt84	T	A	15: 101,530,212	K280M	probably damaging	Het
Krtap9-5	T	A	11: 99,949,069	C199S	unknown	Het
Mrgprb3	A	G	7: 48,643,362	V147A	probably benign	Het
Ndufs6	A	T	13: 73,327,434	F48L	probably damaging	Het
Obscn	T	C	11: 59,079,650	S2586G	probably damaging	Het
Olfr148	A	G	9: 39,614,463	R299G	probably benign	Het
Olfr156	C	A	4: 43,820,912	V150L	probably benign	Het
Olfr559	C	T	7: 102,724,202	R96H	possibly damaging	Het
Osbpl6	A	G	2: 76,584,513	D416G	probably damaging	Het
Pdilt	A	G	7: 119,500,543		probably benign	Het
Phf12	C	A	11: 78,022,426	D401E	probably benign	Het
Pla2r1	C	T	2: 60,428,721	V1108M	possibly damaging	Het
Prim2	A	G	1: 33,480,406		probably benign	Het
Ptpn6	T	C	6: 124,724,984	H406R	probably benign	Het
Qpctl	G	T	7: 19,143,207	H329N	probably damaging	Het
Ripk3	T	A	14: 55,785,298	N390Y	probably damaging	Het
Rnase1	A	G	14: 51,145,450	V149A	probably benign	Het
Rtn3	T	A	19: 7,456,827	D581V	probably damaging	Het
Slamf1	A	G	1: 171,775,062	Y119C	probably damaging	Het
Slc25a34	A	G	4: 141,623,662	M12T	probably benign	Het
Tmem38a	A	G	8: 72,580,100	Y141C	probably damaging	Het
Tnr	C	T	1: 159,886,930	T793I	possibly damaging	Het
Tns3	T	C	11: 8,493,211	D384G	probably damaging	Het
Vmn2r116	T	A	17: 23,387,307	Y398N	probably damaging	Het
Wee1	TCCCC	TCCC	7: 110,124,569		probably null	Het

Other mutations in Cep295

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Cep295	APN	9	15326072	splice site	probably null
IGL00769:Cep295	APN	9	15326144	missense	probably damaging	1.00
IGL00771:Cep295	APN	9	15322565	missense	probably damaging	1.00
IGL00850:Cep295	APN	9	15322852	missense	probably benign	0.36
IGL01505:Cep295	APN	9	15318049	missense	probably benign	0.08
IGL01510:Cep295	APN	9	15354626	nonsense	probably null
IGL01759:Cep295	APN	9	15323559	splice site	probably null
IGL02415:Cep295	APN	9	15353020	missense	probably damaging	1.00
IGL02447:Cep295	APN	9	15332511	missense	probably damaging	0.98
IGL02502:Cep295	APN	9	15350913	splice site	probably benign
IGL02665:Cep295	APN	9	15326632	splice site	probably benign
IGL02718:Cep295	APN	9	15325753	splice site	probably null
IGL02995:Cep295	APN	9	15333312	missense	probably damaging	1.00
IGL03024:Cep295	APN	9	15325572	missense	probably benign
R0196:Cep295	UTSW	9	15338213	missense	probably damaging	0.96
R0398:Cep295	UTSW	9	15354736	missense	possibly damaging	0.90
R0595:Cep295	UTSW	9	15332191	nonsense	probably null
R0610:Cep295	UTSW	9	15322754	missense	possibly damaging	0.81
R0616:Cep295	UTSW	9	15332322	nonsense	probably null
R0840:Cep295	UTSW	9	15334315	missense	probably benign	0.02
R1215:Cep295	UTSW	9	15327882	missense	probably benign	0.00
R1376:Cep295	UTSW	9	15340868	splice site	probably benign
R1381:Cep295	UTSW	9	15322565	missense	probably benign	0.02
R1484:Cep295	UTSW	9	15334784	missense	probably damaging	0.99
R1557:Cep295	UTSW	9	15332010	nonsense	probably null
R1655:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1682:Cep295	UTSW	9	15333921	missense	probably benign	0.02
R1700:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1734:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1736:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1743:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1765:Cep295	UTSW	9	15327904	missense	probably damaging	1.00
R1889:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1895:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1994:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1995:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R2071:Cep295	UTSW	9	15341564	missense	probably damaging	1.00
R2161:Cep295	UTSW	9	15353058	missense	probably damaging	0.99
R2195:Cep295	UTSW	9	15332321	missense	probably damaging	0.99
R2354:Cep295	UTSW	9	15334784	missense	possibly damaging	0.92
R2427:Cep295	UTSW	9	15334238	missense	probably damaging	1.00
R2992:Cep295	UTSW	9	15332747	missense	probably damaging	1.00
R3873:Cep295	UTSW	9	15333365	missense	probably damaging	1.00
R3981:Cep295	UTSW	9	15317067	utr 3 prime	probably benign
R4201:Cep295	UTSW	9	15332538	missense	probably benign	0.19
R4297:Cep295	UTSW	9	15322654	missense	probably benign	0.19
R4543:Cep295	UTSW	9	15335253	missense	possibly damaging	0.94
R4584:Cep295	UTSW	9	15334799	missense	possibly damaging	0.96
R4724:Cep295	UTSW	9	15330832	missense	probably damaging	1.00
R4878:Cep295	UTSW	9	15334956	missense	probably benign	0.11
R4884:Cep295	UTSW	9	15351760	missense	probably damaging	1.00
R4934:Cep295	UTSW	9	15333160	missense	probably damaging	0.97
R4990:Cep295	UTSW	9	15332138	missense	probably damaging	1.00
R5057:Cep295	UTSW	9	15322683	missense	probably benign	0.00
R5153:Cep295	UTSW	9	15357629	missense	probably benign	0.32
R5180:Cep295	UTSW	9	15332120	missense	probably benign
R5285:Cep295	UTSW	9	15322591	missense	probably benign	0.14
R5360:Cep295	UTSW	9	15326733	missense	probably damaging	1.00
R5419:Cep295	UTSW	9	15324237	missense	probably damaging	0.98
R5432:Cep295	UTSW	9	15351695	missense	possibly damaging	0.95
R5625:Cep295	UTSW	9	15340891	missense	probably damaging	0.99
R5637:Cep295	UTSW	9	15333812	splice site	probably null
R5645:Cep295	UTSW	9	15332794	missense	probably damaging	0.98
R5645:Cep295	UTSW	9	15335108	missense	possibly damaging	0.89
R5678:Cep295	UTSW	9	15322858	missense	probably damaging	0.99
R5688:Cep295	UTSW	9	15331986	missense	probably damaging	1.00
R5824:Cep295	UTSW	9	15325656	missense	possibly damaging	0.90
R5837:Cep295	UTSW	9	15346984	missense	probably damaging	0.99
R5915:Cep295	UTSW	9	15341479	missense	probably damaging	1.00
R5988:Cep295	UTSW	9	15341474	missense	probably damaging	1.00
R6239:Cep295	UTSW	9	15322631	missense	possibly damaging	0.46
R6332:Cep295	UTSW	9	15334914	missense	possibly damaging	0.90
R6383:Cep295	UTSW	9	15332754	missense	probably damaging	0.99
R6737:Cep295	UTSW	9	15332351	missense	possibly damaging	0.90
R6929:Cep295	UTSW	9	15333062	missense	probably damaging	1.00
R7428:Cep295	UTSW	9	15333498	missense	possibly damaging	0.61
R7697:Cep295	UTSW	9	15354710	missense	probably benign	0.01
R7963:Cep295	UTSW	9	15333441	missense	possibly damaging	0.90
R8055:Cep295	UTSW	9	15333609	missense	probably benign	0.00
R8069:Cep295	UTSW	9	15322586	missense	possibly damaging	0.94
R8092:Cep295	UTSW	9	15332982	missense	probably benign	0.17
R8117:Cep295	UTSW	9	15334364	missense	probably damaging	0.99
R8140:Cep295	UTSW	9	15341533	missense	probably benign	0.00
R8178:Cep295	UTSW	9	15333540	missense
R8323:Cep295	UTSW	9	15338233	missense	possibly damaging	0.53
R8323:Cep295	UTSW	9	15353061	missense	probably damaging	0.96
R8339:Cep295	UTSW	9	15325550	missense
R8351:Cep295	UTSW	9	15322906	missense	probably damaging	0.99
R8367:Cep295	UTSW	9	15334530	missense	probably benign	0.09
R8725:Cep295	UTSW	9	15332419	nonsense	probably null
R8919:Cep295	UTSW	9	15326711	missense	probably damaging	1.00
R9015:Cep295	UTSW	9	15332968	missense	probably benign	0.00
R9054:Cep295	UTSW	9	15324255	missense	possibly damaging	0.92
R9088:Cep295	UTSW	9	15322519	missense	probably benign	0.09
R9159:Cep295	UTSW	9	15341608	missense	probably benign	0.05
R9243:Cep295	UTSW	9	15332309	missense	probably benign	0.36
R9408:Cep295	UTSW	9	15333323	missense	probably benign	0.00
R9424:Cep295	UTSW	9	15333203	missense	probably damaging	0.98
R9455:Cep295	UTSW	9	15333750	missense	possibly damaging	0.90
R9607:Cep295	UTSW	9	15322713	missense	probably damaging	0.98
R9648:Cep295	UTSW	9	15323607	missense	probably benign	0.00
R9659:Cep295	UTSW	9	15322550	missense	probably benign	0.19
R9731:Cep295	UTSW	9	15333966	missense	possibly damaging	0.94
X0065:Cep295	UTSW	9	15322891	missense	probably benign	0.36
Z1176:Cep295	UTSW	9	15357697	missense	probably damaging	0.99
Z1177:Cep295	UTSW	9	15330817	missense

Predicted Primers

PCR Primer
(F):5'- AAGTCCAACTGCTCTGTCATG -3'
(R):5'- TTCACTCTACTGAGAAAGCCCAAG -3'

Sequencing Primer
(F):5'- CTCTGTCATGTTATTCTGCAGAGGC -3'
(R):5'- TCCCAGACCATGTCAATTTGAAGAG -3'

Posted On

2016-12-15