Incidental Mutation 'R5807:Esrrb'
ID448604
Institutional Source Beutler Lab
Gene Symbol Esrrb
Ensembl Gene ENSMUSG00000021255
Gene Nameestrogen related receptor, beta
SynonymsERR2, Err2, Estrrb, ERRb
MMRRC Submission 043393-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5807 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location86361117-86521628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86514401 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 303 (E303G)
Ref Sequence ENSEMBL: ENSMUSP00000131335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021680] [ENSMUST00000110203] [ENSMUST00000110204] [ENSMUST00000116402] [ENSMUST00000167891]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021680
AA Change: E303G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021680
Gene: ENSMUSG00000021255
AA Change: E303G

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
ZnF_C4 100 171 7.03e-40 SMART
Blast:HOLI 178 208 3e-9 BLAST
HOLI 245 403 6.36e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110203
AA Change: E324G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000105832
Gene: ENSMUSG00000021255
AA Change: E324G

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 121 192 7.03e-40 SMART
HOLI 266 377 6.61e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110204
AA Change: E324G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105833
Gene: ENSMUSG00000021255
AA Change: E324G

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 121 192 7.03e-40 SMART
Blast:HOLI 199 229 3e-9 BLAST
HOLI 266 424 6.36e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116402
AA Change: E308G

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112103
Gene: ENSMUSG00000021255
AA Change: E308G

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
ZnF_C4 105 176 7.03e-40 SMART
Blast:HOLI 183 213 3e-9 BLAST
HOLI 250 408 6.36e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136464
Predicted Effect possibly damaging
Transcript: ENSMUST00000167891
AA Change: E303G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131335
Gene: ENSMUSG00000021255
AA Change: E303G

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
ZnF_C4 100 171 7.03e-40 SMART
Blast:HOLI 178 208 3e-9 BLAST
HOLI 245 403 6.36e-38 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the estrogen receptor. Its function is unknown; however, a similar protein in mouse plays an essential role in placental development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around E9.5 or E10.5 as a result of failure of the chorion to develop and subsequent placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,303,492 L943P probably damaging Het
Abcg5 C A 17: 84,672,291 V214F probably damaging Het
Ang T A 14: 51,101,429 probably benign Het
Arfgef3 A G 10: 18,647,798 probably null Het
Arhgef4 A G 1: 34,807,615 probably benign Het
Atp11b T C 3: 35,812,279 I409T probably damaging Het
Atp5b G A 10: 128,088,562 probably benign Het
Atp9a G A 2: 168,653,534 A660V probably damaging Het
Avpr1a A G 10: 122,449,471 T223A probably benign Het
Bmp2k T C 5: 97,063,494 M507T unknown Het
Cep295 A G 9: 15,332,532 S287P probably damaging Het
Chrna7 T A 7: 63,148,601 D111V probably damaging Het
Cnr2 A G 4: 135,917,436 D275G probably benign Het
Col28a1 T A 6: 8,158,144 M305L probably benign Het
Cpb1 T A 3: 20,263,742 D206V probably damaging Het
Cyp2c50 T C 19: 40,113,500 L453S probably damaging Het
Ddx52 T G 11: 83,949,682 S284A probably benign Het
Efcab1 A T 16: 14,916,972 I69F probably benign Het
Eif2ak4 G T 2: 118,388,851 R48L probably benign Het
Fbxo21 A G 5: 117,976,868 E23G probably benign Het
Fcamr T C 1: 130,811,526 S188P probably damaging Het
Fer1l6 C A 15: 58,590,550 S818* probably null Het
Fn1 T C 1: 71,648,059 D213G probably damaging Het
Gcg A G 2: 62,475,725 I176T possibly damaging Het
Glis1 T A 4: 107,568,082 S109T probably benign Het
Gm266 T C 12: 111,485,739 D11G probably benign Het
Gm5070 C A 3: 95,410,654 noncoding transcript Het
Gm8444 T C 15: 81,843,453 probably benign Het
Gm8989 T A 7: 106,330,223 noncoding transcript Het
Golga4 A G 9: 118,527,130 T117A probably damaging Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Herc2 T A 7: 56,230,919 F4766L probably damaging Het
Inhbc C A 10: 127,357,542 E202* probably null Het
Kcnu1 C T 8: 25,849,714 T20I possibly damaging Het
Klhdc3 T C 17: 46,677,465 D161G probably damaging Het
Krt84 T A 15: 101,530,212 K280M probably damaging Het
Krtap9-5 T A 11: 99,949,069 C199S unknown Het
Mrgprb3 A G 7: 48,643,362 V147A probably benign Het
Ndufs6 A T 13: 73,327,434 F48L probably damaging Het
Obscn T C 11: 59,079,650 S2586G probably damaging Het
Olfr148 A G 9: 39,614,463 R299G probably benign Het
Olfr156 C A 4: 43,820,912 V150L probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Osbpl6 A G 2: 76,584,513 D416G probably damaging Het
Pdilt A G 7: 119,500,543 probably benign Het
Phf12 C A 11: 78,022,426 D401E probably benign Het
Pla2r1 C T 2: 60,428,721 V1108M possibly damaging Het
Prim2 A G 1: 33,480,406 probably benign Het
Ptpn6 T C 6: 124,724,984 H406R probably benign Het
Qpctl G T 7: 19,143,207 H329N probably damaging Het
Ripk3 T A 14: 55,785,298 N390Y probably damaging Het
Rnase1 A G 14: 51,145,450 V149A probably benign Het
Rtn3 T A 19: 7,456,827 D581V probably damaging Het
Slamf1 A G 1: 171,775,062 Y119C probably damaging Het
Slc25a34 A G 4: 141,623,662 M12T probably benign Het
Tmem38a A G 8: 72,580,100 Y141C probably damaging Het
Tnr C T 1: 159,886,930 T793I possibly damaging Het
Tns3 T C 11: 8,493,211 D384G probably damaging Het
Vmn2r116 T A 17: 23,387,307 Y398N probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Other mutations in Esrrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02621:Esrrb APN 12 86421961 missense probably benign
R0083:Esrrb UTSW 12 86514452 missense probably damaging 1.00
R0194:Esrrb UTSW 12 86470481 missense probably damaging 1.00
R0666:Esrrb UTSW 12 86505902 missense probably benign 0.01
R0834:Esrrb UTSW 12 86470297 missense probably benign 0.14
R0946:Esrrb UTSW 12 86505824 missense probably damaging 1.00
R1108:Esrrb UTSW 12 86505830 missense probably damaging 1.00
R1619:Esrrb UTSW 12 86514500 missense possibly damaging 0.78
R1674:Esrrb UTSW 12 86514451 missense probably damaging 1.00
R2139:Esrrb UTSW 12 86421966 critical splice donor site probably null
R4592:Esrrb UTSW 12 86518830 missense probably damaging 1.00
R5377:Esrrb UTSW 12 86519009 nonsense probably null
R5871:Esrrb UTSW 12 86505887 missense probably benign 0.29
R6145:Esrrb UTSW 12 86505899 missense probably benign
R6467:Esrrb UTSW 12 86514340 missense probably damaging 1.00
R7098:Esrrb UTSW 12 86470415 missense probably benign 0.01
R7289:Esrrb UTSW 12 86470557 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATGCAAGGACACAGCTCAC -3'
(R):5'- TGTTAGGCTCCCACAGAACC -3'

Sequencing Primer
(F):5'- TCCAGCAAGCGCCAAGG -3'
(R):5'- GAACCCCTGAAGCCCTCTGAG -3'
Posted On2016-12-15