Incidental Mutation 'R5635:Sp100'
ID 448620
Institutional Source Beutler Lab
Gene Symbol Sp100
Ensembl Gene ENSMUSG00000026222
Gene Name nuclear antigen Sp100
Synonyms A430075G10Rik
MMRRC Submission 043286-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R5635 (G1)
Quality Score 177
Status Validated
Chromosome 1
Chromosomal Location 85577709-85637719 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) C to A at 85609985 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054279] [ENSMUST00000066427] [ENSMUST00000145440] [ENSMUST00000147552] [ENSMUST00000150967] [ENSMUST00000153574] [ENSMUST00000155094]
AlphaFold O35892
Predicted Effect unknown
Transcript: ENSMUST00000054279
AA Change: Q346K
SMART Domains Protein: ENSMUSP00000051705
Gene: ENSMUSG00000026222
AA Change: Q346K

DomainStartEndE-ValueType
Pfam:Sp100 19 122 4.9e-47 PFAM
low complexity region 334 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066427
SMART Domains Protein: ENSMUSP00000066399
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 21 119 3.4e-40 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
BROMO 473 573 1.16e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140758
Predicted Effect probably benign
Transcript: ENSMUST00000145440
SMART Domains Protein: ENSMUSP00000120604
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147552
SMART Domains Protein: ENSMUSP00000116942
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.5e-46 PFAM
low complexity region 305 319 N/A INTRINSIC
low complexity region 349 359 N/A INTRINSIC
SAND 368 441 8.85e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150967
SMART Domains Protein: ENSMUSP00000122899
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.1e-46 PFAM
low complexity region 324 334 N/A INTRINSIC
SAND 343 416 8.85e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153574
SMART Domains Protein: ENSMUSP00000122670
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 9.2e-47 PFAM
low complexity region 342 352 N/A INTRINSIC
SAND 361 434 8.85e-38 SMART
Blast:BROMO 453 476 9e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155094
SMART Domains Protein: ENSMUSP00000118481
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 1.6e-46 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
Meta Mutation Damage Score 0.0802 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,094,273 (GRCm39) M53K possibly damaging Het
Aldh3b3 C T 19: 4,018,512 (GRCm39) T409I probably benign Het
Ankrd13a C A 5: 114,939,778 (GRCm39) H468Q possibly damaging Het
Ap2a1 A C 7: 44,573,325 (GRCm39) probably benign Het
Arfgef1 A T 1: 10,259,085 (GRCm39) S671T possibly damaging Het
C1ra G A 6: 124,493,683 (GRCm39) C145Y probably damaging Het
Catsperd G A 17: 56,939,335 (GRCm39) V55M possibly damaging Het
Ccdc30 T C 4: 119,216,871 (GRCm39) N123D possibly damaging Het
Cdc20 A T 4: 118,293,224 (GRCm39) V232E possibly damaging Het
Cfap251 A T 5: 123,460,635 (GRCm39) Q225L probably benign Het
Cfap58 T A 19: 47,971,981 (GRCm39) V637E possibly damaging Het
Coq4 T A 2: 29,678,367 (GRCm39) V24E possibly damaging Het
Crim1 T A 17: 78,623,070 (GRCm39) F423I probably damaging Het
Crls1 T C 2: 132,706,062 (GRCm39) V262A possibly damaging Het
Crybb1 T C 5: 112,405,425 (GRCm39) probably null Het
Cutc T A 19: 43,744,069 (GRCm39) N23K probably benign Het
Cxcl10 T A 5: 92,495,698 (GRCm39) I82F probably damaging Het
Cyp3a44 A T 5: 145,738,124 (GRCm39) F60L possibly damaging Het
Dhx9 A G 1: 153,359,493 (GRCm39) M35T probably benign Het
Dnah8 A G 17: 30,925,360 (GRCm39) E1265G probably benign Het
Dzank1 C G 2: 144,325,327 (GRCm39) D548H probably damaging Het
Eef2kmt A G 16: 5,066,893 (GRCm39) V120A probably damaging Het
Elp4 A G 2: 105,644,609 (GRCm39) probably null Het
Etl4 A T 2: 20,811,846 (GRCm39) I1310F probably damaging Het
Exoc6b A T 6: 84,828,909 (GRCm39) F492I probably damaging Het
F2rl2 A T 13: 95,837,290 (GRCm39) I112F possibly damaging Het
Farp1 T A 14: 121,513,716 (GRCm39) I837N possibly damaging Het
Fars2 A G 13: 36,594,129 (GRCm39) E378G probably damaging Het
Fgg A G 3: 82,918,730 (GRCm39) T248A probably benign Het
Flrt3 T A 2: 140,502,420 (GRCm39) T403S probably damaging Het
Fndc3b C T 3: 27,596,080 (GRCm39) E170K probably damaging Het
Gm17728 A G 17: 9,641,202 (GRCm39) H104R probably benign Het
H2ac21 C A 3: 96,127,593 (GRCm39) T121K possibly damaging Het
Hivep1 A G 13: 42,313,603 (GRCm39) T1948A probably benign Het
Hspa4l T A 3: 40,700,177 (GRCm39) I23N probably damaging Het
Ighv1-75 A G 12: 115,797,829 (GRCm39) V31A probably benign Het
Kalrn T A 16: 33,834,454 (GRCm39) N627I probably damaging Het
Lrp1b T G 2: 42,542,834 (GRCm39) probably benign Het
Lrrc36 G A 8: 106,184,205 (GRCm39) V480M probably damaging Het
Map4k3 A T 17: 80,920,924 (GRCm39) N534K possibly damaging Het
Mybpc3 C T 2: 90,965,174 (GRCm39) T1081I probably benign Het
Nfrkb T C 9: 31,310,594 (GRCm39) S351P probably damaging Het
Nme4 A T 17: 26,313,205 (GRCm39) V43E probably damaging Het
Notch1 C T 2: 26,366,173 (GRCm39) E794K probably damaging Het
Nufip1 A T 14: 76,363,586 (GRCm39) K270M probably damaging Het
Or10ak16 G T 4: 118,750,832 (GRCm39) G184V probably benign Het
Or1e30 G T 11: 73,678,460 (GRCm39) R232L probably benign Het
Or51b6 G A 7: 103,555,845 (GRCm39) M66I probably benign Het
Or5t5 A G 2: 86,616,070 (GRCm39) probably null Het
Or8g51 A G 9: 38,609,455 (GRCm39) I73T possibly damaging Het
Pcdhb15 T A 18: 37,606,823 (GRCm39) Y18* probably null Het
Pcdhb21 A T 18: 37,646,970 (GRCm39) Y33F probably benign Het
Pds5b T A 5: 150,701,686 (GRCm39) H772Q possibly damaging Het
Pik3r4 C A 9: 105,545,024 (GRCm39) H168N probably benign Het
Pitpnm3 A G 11: 71,957,986 (GRCm39) S386P possibly damaging Het
Plg A G 17: 12,614,641 (GRCm39) H307R probably damaging Het
Prdm9 A C 17: 15,782,702 (GRCm39) D96E probably damaging Het
Prmt8 A G 6: 127,745,692 (GRCm39) S7P probably damaging Het
Prune2 T C 19: 17,095,573 (GRCm39) V359A probably benign Het
Pxn A T 5: 115,689,551 (GRCm39) Q279L probably benign Het
Rarb A T 14: 16,443,788 (GRCm38) C167S probably damaging Het
Rps6kb2 T A 19: 4,211,133 (GRCm39) I131F probably damaging Het
Sec14l3 T A 11: 4,021,484 (GRCm39) V219E probably damaging Het
Simc1 A G 13: 54,673,217 (GRCm39) T522A probably benign Het
Slc1a6 T C 10: 78,624,925 (GRCm39) V110A possibly damaging Het
Slc38a11 T G 2: 65,191,747 (GRCm39) probably null Het
Snx13 T A 12: 35,190,170 (GRCm39) D840E probably benign Het
Spc24 G T 9: 21,668,686 (GRCm39) L104I probably damaging Het
Surf4 T C 2: 26,823,325 (GRCm39) N4D probably benign Het
Tas2r131 A T 6: 132,934,571 (GRCm39) D79E probably benign Het
Tbc1d20 T C 2: 152,153,381 (GRCm39) S304P probably benign Het
Tbrg1 T C 9: 37,566,287 (GRCm39) probably benign Het
Tmem214 A G 5: 31,028,861 (GRCm39) N150S probably damaging Het
Trappc13 A T 13: 104,286,606 (GRCm39) I217K probably benign Het
Ttc41 T A 10: 86,572,841 (GRCm39) C738S probably benign Het
Ttn T C 2: 76,540,068 (GRCm39) Q25979R probably benign Het
Tubb2b A T 13: 34,312,180 (GRCm39) N204K probably damaging Het
Ube3a T A 7: 58,938,236 (GRCm39) M713K probably damaging Het
Usp37 T C 1: 74,534,970 (GRCm39) probably benign Het
Vegfb T A 19: 6,960,214 (GRCm39) *189C probably null Het
Vmn2r82 A G 10: 79,214,652 (GRCm39) N212D probably benign Het
Vta1 A T 10: 14,543,866 (GRCm39) probably null Het
Xdh T G 17: 74,220,870 (GRCm39) I620L possibly damaging Het
Xpnpep3 A G 15: 81,320,970 (GRCm39) Y283C probably benign Het
Zscan18 A G 7: 12,504,791 (GRCm39) S609P probably benign Het
Other mutations in Sp100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Sp100 APN 1 85,597,741 (GRCm39) missense possibly damaging 0.48
IGL01998:Sp100 APN 1 85,594,650 (GRCm39) missense probably benign 0.01
IGL02192:Sp100 APN 1 85,635,722 (GRCm39) missense probably damaging 0.99
IGL02809:Sp100 APN 1 85,608,845 (GRCm39) missense probably damaging 0.99
IGL03274:Sp100 APN 1 85,635,025 (GRCm39) intron probably benign
PIT4458001:Sp100 UTSW 1 85,635,837 (GRCm39) missense probably benign 0.10
R0115:Sp100 UTSW 1 85,577,852 (GRCm39) splice site probably benign
R0599:Sp100 UTSW 1 85,608,831 (GRCm39) missense possibly damaging 0.68
R0620:Sp100 UTSW 1 85,587,588 (GRCm39) splice site probably null
R0693:Sp100 UTSW 1 85,594,726 (GRCm39) critical splice donor site probably null
R0709:Sp100 UTSW 1 85,622,002 (GRCm39) missense probably damaging 0.96
R0744:Sp100 UTSW 1 85,627,465 (GRCm39) missense probably damaging 0.97
R0836:Sp100 UTSW 1 85,627,465 (GRCm39) missense probably damaging 0.97
R1175:Sp100 UTSW 1 85,629,141 (GRCm39) missense possibly damaging 0.83
R1496:Sp100 UTSW 1 85,591,242 (GRCm39) splice site probably benign
R1749:Sp100 UTSW 1 85,627,357 (GRCm39) missense possibly damaging 0.95
R2046:Sp100 UTSW 1 85,636,786 (GRCm39) missense possibly damaging 0.53
R2069:Sp100 UTSW 1 85,608,863 (GRCm39) splice site probably null
R2441:Sp100 UTSW 1 85,631,210 (GRCm39) unclassified probably benign
R3933:Sp100 UTSW 1 85,608,830 (GRCm39) missense probably benign 0.29
R4171:Sp100 UTSW 1 85,634,562 (GRCm39) missense probably benign 0.00
R4762:Sp100 UTSW 1 85,629,179 (GRCm39) makesense probably null
R4863:Sp100 UTSW 1 85,632,724 (GRCm39) missense probably benign 0.03
R5156:Sp100 UTSW 1 85,601,404 (GRCm39) missense probably damaging 1.00
R5273:Sp100 UTSW 1 85,636,825 (GRCm39) missense possibly damaging 0.86
R5810:Sp100 UTSW 1 85,593,006 (GRCm39) missense probably benign 0.12
R5910:Sp100 UTSW 1 85,608,861 (GRCm39) critical splice donor site probably null
R5931:Sp100 UTSW 1 85,606,804 (GRCm39) missense probably damaging 1.00
R7466:Sp100 UTSW 1 85,634,960 (GRCm39) missense possibly damaging 0.93
R7514:Sp100 UTSW 1 85,608,860 (GRCm39) nonsense probably null
R7647:Sp100 UTSW 1 85,619,764 (GRCm39) missense possibly damaging 0.91
R7851:Sp100 UTSW 1 85,634,647 (GRCm39) missense probably benign 0.12
R7908:Sp100 UTSW 1 85,635,788 (GRCm39) missense possibly damaging 0.51
R8064:Sp100 UTSW 1 85,608,860 (GRCm39) nonsense probably null
R8094:Sp100 UTSW 1 85,624,819 (GRCm39) missense possibly damaging 0.95
R8757:Sp100 UTSW 1 85,590,285 (GRCm39) missense possibly damaging 0.92
R8785:Sp100 UTSW 1 85,627,472 (GRCm39) critical splice donor site probably benign
R9382:Sp100 UTSW 1 85,627,336 (GRCm39) missense probably damaging 0.99
R9453:Sp100 UTSW 1 85,629,179 (GRCm39) makesense probably null
R9464:Sp100 UTSW 1 85,624,751 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACTTTACAGATGGAGCCATTTC -3'
(R):5'- TTCCATATCAGCAGTACATAAGCAC -3'

Sequencing Primer
(F):5'- GAGCCATTTCTCCAGCCC -3'
(R):5'- ACAAATGTTCATAGTCACTTCCTGC -3'
Posted On 2016-12-15