Incidental Mutation 'R5635:Dhx9'
ID448621
Institutional Source Beutler Lab
Gene Symbol Dhx9
Ensembl Gene ENSMUSG00000042699
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 9
Synonymsleukophysin, Ddx9, RNA helicase, nuclear DNA helicase II, NDHII, NDH II, RHA
MMRRC Submission 043286-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5635 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location153455758-153487660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153483747 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 35 (M35T)
Ref Sequence ENSEMBL: ENSMUSP00000038135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042141] [ENSMUST00000186380] [ENSMUST00000186966] [ENSMUST00000188345]
Predicted Effect probably benign
Transcript: ENSMUST00000042141
AA Change: M35T

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038135
Gene: ENSMUSG00000042699
AA Change: M35T

DomainStartEndE-ValueType
DSRM 4 70 2.23e-17 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 3.52e-15 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 1.61e-25 SMART
low complexity region 592 608 N/A INTRINSIC
HELICc 667 772 4.69e-18 SMART
HA2 834 922 1.33e-24 SMART
Pfam:OB_NTP_bind 961 1077 1.6e-18 PFAM
low complexity region 1173 1309 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1339 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186380
AA Change: M35T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139825
Gene: ENSMUSG00000042699
AA Change: M35T

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 388 575 6.6e-28 SMART
low complexity region 591 607 N/A INTRINSIC
HELICc 666 771 1.9e-20 SMART
HA2 833 921 9.9e-29 SMART
Pfam:OB_NTP_bind 960 1076 5e-13 PFAM
low complexity region 1172 1308 N/A INTRINSIC
low complexity region 1312 1336 N/A INTRINSIC
low complexity region 1338 1383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186966
AA Change: M35T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139806
Gene: ENSMUSG00000042699
AA Change: M35T

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
Blast:DEXDc 349 451 1e-37 BLAST
PDB:3LLM|B 349 456 2e-55 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188345
AA Change: M35T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139827
Gene: ENSMUSG00000042699
AA Change: M35T

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 2.1e-17 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 6.6e-28 SMART
low complexity region 592 608 N/A INTRINSIC
Pfam:Helicase_C 678 735 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190383
Meta Mutation Damage Score 0.0801 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes die in embryonic stages with massive apoptotic cell death in embryonic ectodermal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,218,277 M53K possibly damaging Het
Aldh3b3 C T 19: 3,968,512 T409I probably benign Het
Ankrd13a C A 5: 114,801,717 H468Q possibly damaging Het
Ap2a1 A C 7: 44,923,901 probably benign Het
Arfgef1 A T 1: 10,188,860 S671T possibly damaging Het
C1ra G A 6: 124,516,724 C145Y probably damaging Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ccdc30 T C 4: 119,359,674 N123D possibly damaging Het
Cdc20 A T 4: 118,436,027 V232E possibly damaging Het
Cfap58 T A 19: 47,983,542 V637E possibly damaging Het
Coq4 T A 2: 29,788,355 V24E possibly damaging Het
Crim1 T A 17: 78,315,641 F423I probably damaging Het
Crls1 T C 2: 132,864,142 V262A possibly damaging Het
Crybb1 T C 5: 112,257,559 probably null Het
Cutc T A 19: 43,755,630 N23K probably benign Het
Cxcl10 T A 5: 92,347,839 I82F probably damaging Het
Cyp3a44 A T 5: 145,801,314 F60L possibly damaging Het
Dnah8 A G 17: 30,706,386 E1265G probably benign Het
Dzank1 C G 2: 144,483,407 D548H probably damaging Het
Eef2kmt A G 16: 5,249,029 V120A probably damaging Het
Elp4 A G 2: 105,814,264 probably null Het
Etl4 A T 2: 20,807,035 I1310F probably damaging Het
Exoc6b A T 6: 84,851,927 F492I probably damaging Het
F2rl2 A T 13: 95,700,782 I112F possibly damaging Het
Farp1 T A 14: 121,276,304 I837N possibly damaging Het
Fars2 A G 13: 36,410,146 E378G probably damaging Het
Fgg A G 3: 83,011,423 T248A probably benign Het
Flrt3 T A 2: 140,660,500 T403S probably damaging Het
Fndc3b C T 3: 27,541,931 E170K probably damaging Het
Gm17728 A G 17: 9,422,370 H104R probably benign Het
Hist2h2ab C A 3: 96,220,277 T121K possibly damaging Het
Hivep1 A G 13: 42,160,127 T1948A probably benign Het
Hspa4l T A 3: 40,745,745 I23N probably damaging Het
Ighv1-75 A G 12: 115,834,209 V31A probably benign Het
Kalrn T A 16: 34,014,084 N627I probably damaging Het
Lrp1b T G 2: 42,652,822 probably benign Het
Lrrc36 G A 8: 105,457,573 V480M probably damaging Het
Map4k3 A T 17: 80,613,495 N534K possibly damaging Het
Mybpc3 C T 2: 91,134,829 T1081I probably benign Het
Nfrkb T C 9: 31,399,298 S351P probably damaging Het
Nme4 A T 17: 26,094,231 V43E probably damaging Het
Notch1 C T 2: 26,476,161 E794K probably damaging Het
Nufip1 A T 14: 76,126,146 K270M probably damaging Het
Olfr1093 A G 2: 86,785,726 probably null Het
Olfr1330 G T 4: 118,893,635 G184V probably benign Het
Olfr390 G T 11: 73,787,634 R232L probably benign Het
Olfr65 G A 7: 103,906,638 M66I probably benign Het
Olfr919 A G 9: 38,698,159 I73T possibly damaging Het
Pcdhb15 T A 18: 37,473,770 Y18* probably null Het
Pcdhb21 A T 18: 37,513,917 Y33F probably benign Het
Pds5b T A 5: 150,778,221 H772Q possibly damaging Het
Pik3r4 C A 9: 105,667,825 H168N probably benign Het
Pitpnm3 A G 11: 72,067,160 S386P possibly damaging Het
Plg A G 17: 12,395,754 H307R probably damaging Het
Prdm9 A C 17: 15,562,440 D96E probably damaging Het
Prmt8 A G 6: 127,768,729 S7P probably damaging Het
Prune2 T C 19: 17,118,209 V359A probably benign Het
Pxn A T 5: 115,551,492 Q279L probably benign Het
Rarb A T 14: 16,443,788 C167S probably damaging Het
Rps6kb2 T A 19: 4,161,134 I131F probably damaging Het
Sec14l3 T A 11: 4,071,484 V219E probably damaging Het
Simc1 A G 13: 54,525,404 T522A probably benign Het
Slc1a6 T C 10: 78,789,091 V110A possibly damaging Het
Slc38a11 T G 2: 65,361,403 probably null Het
Snx13 T A 12: 35,140,171 D840E probably benign Het
Sp100 C A 1: 85,682,264 probably benign Het
Spc24 G T 9: 21,757,390 L104I probably damaging Het
Surf4 T C 2: 26,933,313 N4D probably benign Het
Tas2r131 A T 6: 132,957,608 D79E probably benign Het
Tbc1d20 T C 2: 152,311,461 S304P probably benign Het
Tbrg1 T C 9: 37,654,991 probably benign Het
Tmem214 A G 5: 30,871,517 N150S probably damaging Het
Trappc13 A T 13: 104,150,098 I217K probably benign Het
Ttc41 T A 10: 86,736,977 C738S probably benign Het
Ttn T C 2: 76,709,724 Q25979R probably benign Het
Tubb2b A T 13: 34,128,197 N204K probably damaging Het
Ube3a T A 7: 59,288,488 M713K probably damaging Het
Usp37 T C 1: 74,495,811 probably benign Het
Vegfb T A 19: 6,982,846 *189C probably null Het
Vmn2r82 A G 10: 79,378,818 N212D probably benign Het
Vta1 A T 10: 14,668,122 probably null Het
Wdr66 A T 5: 123,322,572 Q225L probably benign Het
Xdh T G 17: 73,913,875 I620L possibly damaging Het
Xpnpep3 A G 15: 81,436,769 Y283C probably benign Het
Zscan18 A G 7: 12,770,864 S609P probably benign Het
Other mutations in Dhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Dhx9 APN 1 153465748 missense probably damaging 1.00
IGL01284:Dhx9 APN 1 153464898 missense probably damaging 1.00
IGL01555:Dhx9 APN 1 153459566 missense probably damaging 1.00
IGL01767:Dhx9 APN 1 153468868 splice site probably benign
IGL02938:Dhx9 APN 1 153464630 missense probably benign 0.37
R0001:Dhx9 UTSW 1 153462636 missense probably damaging 1.00
R0046:Dhx9 UTSW 1 153472707 missense probably benign 0.27
R0309:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R0517:Dhx9 UTSW 1 153478916 missense possibly damaging 0.93
R0589:Dhx9 UTSW 1 153472291 missense probably damaging 1.00
R1217:Dhx9 UTSW 1 153458363 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1430:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R1456:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R1460:Dhx9 UTSW 1 153465680 missense probably benign 0.01
R1724:Dhx9 UTSW 1 153458488 missense probably benign 0.00
R1848:Dhx9 UTSW 1 153465753 missense probably damaging 0.99
R1922:Dhx9 UTSW 1 153460274 splice site probably null
R2001:Dhx9 UTSW 1 153456111 nonsense probably null
R3084:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3085:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3123:Dhx9 UTSW 1 153465706 missense possibly damaging 0.90
R3730:Dhx9 UTSW 1 153478120 missense probably benign 0.16
R4274:Dhx9 UTSW 1 153468926 missense probably damaging 1.00
R4353:Dhx9 UTSW 1 153471789 missense probably damaging 1.00
R4560:Dhx9 UTSW 1 153467157 missense probably damaging 1.00
R4583:Dhx9 UTSW 1 153460303 missense probably damaging 0.98
R4598:Dhx9 UTSW 1 153467051 frame shift probably null
R4603:Dhx9 UTSW 1 153467051 frame shift probably null
R4889:Dhx9 UTSW 1 153481149 missense probably damaging 1.00
R4931:Dhx9 UTSW 1 153472673 missense probably benign 0.02
R5411:Dhx9 UTSW 1 153481223 missense probably benign 0.27
R5569:Dhx9 UTSW 1 153467092 missense possibly damaging 0.83
R5659:Dhx9 UTSW 1 153471735 missense probably damaging 1.00
R6128:Dhx9 UTSW 1 153478089 missense probably damaging 1.00
R6215:Dhx9 UTSW 1 153472463 missense probably damaging 1.00
R6428:Dhx9 UTSW 1 153456578 unclassified probably benign
R6489:Dhx9 UTSW 1 153456643 unclassified probably benign
R6717:Dhx9 UTSW 1 153473464 splice site probably null
R7098:Dhx9 UTSW 1 153465022 missense probably benign
R7209:Dhx9 UTSW 1 153464623 missense possibly damaging 0.90
R7226:Dhx9 UTSW 1 153465677 missense probably benign 0.00
R7440:Dhx9 UTSW 1 153481231 missense probably benign
R7685:Dhx9 UTSW 1 153458406 missense probably damaging 0.99
R7712:Dhx9 UTSW 1 153465001 missense probably benign 0.07
R8088:Dhx9 UTSW 1 153462697 missense probably benign 0.26
R8371:Dhx9 UTSW 1 153456215 missense unknown
R8397:Dhx9 UTSW 1 153468911 missense probably damaging 1.00
R8502:Dhx9 UTSW 1 153459464 missense probably benign 0.01
R8519:Dhx9 UTSW 1 153473176 missense probably damaging 1.00
R8531:Dhx9 UTSW 1 153458436 missense possibly damaging 0.95
R8842:Dhx9 UTSW 1 153462589 missense possibly damaging 0.91
X0066:Dhx9 UTSW 1 153472529 missense probably benign 0.00
Z1177:Dhx9 UTSW 1 153456575 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCTAGCCAAGTATTGCAAG -3'
(R):5'- TTGCTGGGAGGGATAACTTTAAAG -3'

Sequencing Primer
(F):5'- CCCTAGCCAAGTATTGCAAGATAATG -3'
(R):5'- ATTCATTGTAGAATGTAGGATACAGC -3'
Posted On2016-12-15