Incidental Mutation 'R5635:Tbc1d20'
ID448634
Institutional Source Beutler Lab
Gene Symbol Tbc1d20
Ensembl Gene ENSMUSG00000027465
Gene NameTBC1 domain family, member 20
Synonyms
MMRRC Submission 043286-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R5635 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152293828-152313996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152311461 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 304 (S304P)
Ref Sequence ENSEMBL: ENSMUSP00000028963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028963] [ENSMUST00000028964] [ENSMUST00000109847] [ENSMUST00000144252] [ENSMUST00000147591]
Predicted Effect probably benign
Transcript: ENSMUST00000028963
AA Change: S304P

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028963
Gene: ENSMUSG00000027465
AA Change: S304P

DomainStartEndE-ValueType
TBC 56 268 6.19e-5 SMART
low complexity region 304 323 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028964
SMART Domains Protein: ENSMUSP00000028964
Gene: ENSMUSG00000027466

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Pfam:IBR 346 409 1.5e-9 PFAM
Pfam:IBR 422 483 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109847
SMART Domains Protein: ENSMUSP00000105473
Gene: ENSMUSG00000027466

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Blast:IBR 427 507 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141373
Predicted Effect probably benign
Transcript: ENSMUST00000144252
SMART Domains Protein: ENSMUSP00000122542
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
Pfam:RabGAP-TBC 8 80 5.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147591
SMART Domains Protein: ENSMUSP00000119209
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
Pfam:RabGAP-TBC 11 155 2e-24 PFAM
Meta Mutation Damage Score 0.2076 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of GTPase activator proteins of Rab-like small GTPases. The encoded protein and its cognate GTPase, Rab1, bind the nonstructural protein 5A (NS5A) of the hepatitis C virus (HCV) to mediate viral replication. Depletion of this protein inhibits replication of the virus and HCV infection. Mutations in this gene are associated with Warburg micro syndrome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous mutants have bilateral cataracts, small eyes, glossy coats, and are male sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,218,277 M53K possibly damaging Het
Aldh3b3 C T 19: 3,968,512 T409I probably benign Het
Ankrd13a C A 5: 114,801,717 H468Q possibly damaging Het
Ap2a1 A C 7: 44,923,901 probably benign Het
Arfgef1 A T 1: 10,188,860 S671T possibly damaging Het
C1ra G A 6: 124,516,724 C145Y probably damaging Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ccdc30 T C 4: 119,359,674 N123D possibly damaging Het
Cdc20 A T 4: 118,436,027 V232E possibly damaging Het
Cfap58 T A 19: 47,983,542 V637E possibly damaging Het
Coq4 T A 2: 29,788,355 V24E possibly damaging Het
Crim1 T A 17: 78,315,641 F423I probably damaging Het
Crls1 T C 2: 132,864,142 V262A possibly damaging Het
Crybb1 T C 5: 112,257,559 probably null Het
Cutc T A 19: 43,755,630 N23K probably benign Het
Cxcl10 T A 5: 92,347,839 I82F probably damaging Het
Cyp3a44 A T 5: 145,801,314 F60L possibly damaging Het
Dhx9 A G 1: 153,483,747 M35T probably benign Het
Dnah8 A G 17: 30,706,386 E1265G probably benign Het
Dzank1 C G 2: 144,483,407 D548H probably damaging Het
Eef2kmt A G 16: 5,249,029 V120A probably damaging Het
Elp4 A G 2: 105,814,264 probably null Het
Etl4 A T 2: 20,807,035 I1310F probably damaging Het
Exoc6b A T 6: 84,851,927 F492I probably damaging Het
F2rl2 A T 13: 95,700,782 I112F possibly damaging Het
Farp1 T A 14: 121,276,304 I837N possibly damaging Het
Fars2 A G 13: 36,410,146 E378G probably damaging Het
Fgg A G 3: 83,011,423 T248A probably benign Het
Flrt3 T A 2: 140,660,500 T403S probably damaging Het
Fndc3b C T 3: 27,541,931 E170K probably damaging Het
Gm17728 A G 17: 9,422,370 H104R probably benign Het
Hist2h2ab C A 3: 96,220,277 T121K possibly damaging Het
Hivep1 A G 13: 42,160,127 T1948A probably benign Het
Hspa4l T A 3: 40,745,745 I23N probably damaging Het
Ighv1-75 A G 12: 115,834,209 V31A probably benign Het
Kalrn T A 16: 34,014,084 N627I probably damaging Het
Lrp1b T G 2: 42,652,822 probably benign Het
Lrrc36 G A 8: 105,457,573 V480M probably damaging Het
Map4k3 A T 17: 80,613,495 N534K possibly damaging Het
Mybpc3 C T 2: 91,134,829 T1081I probably benign Het
Nfrkb T C 9: 31,399,298 S351P probably damaging Het
Nme4 A T 17: 26,094,231 V43E probably damaging Het
Notch1 C T 2: 26,476,161 E794K probably damaging Het
Nufip1 A T 14: 76,126,146 K270M probably damaging Het
Olfr1093 A G 2: 86,785,726 probably null Het
Olfr1330 G T 4: 118,893,635 G184V probably benign Het
Olfr390 G T 11: 73,787,634 R232L probably benign Het
Olfr65 G A 7: 103,906,638 M66I probably benign Het
Olfr919 A G 9: 38,698,159 I73T possibly damaging Het
Pcdhb15 T A 18: 37,473,770 Y18* probably null Het
Pcdhb21 A T 18: 37,513,917 Y33F probably benign Het
Pds5b T A 5: 150,778,221 H772Q possibly damaging Het
Pik3r4 C A 9: 105,667,825 H168N probably benign Het
Pitpnm3 A G 11: 72,067,160 S386P possibly damaging Het
Plg A G 17: 12,395,754 H307R probably damaging Het
Prdm9 A C 17: 15,562,440 D96E probably damaging Het
Prmt8 A G 6: 127,768,729 S7P probably damaging Het
Prune2 T C 19: 17,118,209 V359A probably benign Het
Pxn A T 5: 115,551,492 Q279L probably benign Het
Rarb A T 14: 16,443,788 C167S probably damaging Het
Rps6kb2 T A 19: 4,161,134 I131F probably damaging Het
Sec14l3 T A 11: 4,071,484 V219E probably damaging Het
Simc1 A G 13: 54,525,404 T522A probably benign Het
Slc1a6 T C 10: 78,789,091 V110A possibly damaging Het
Slc38a11 T G 2: 65,361,403 probably null Het
Snx13 T A 12: 35,140,171 D840E probably benign Het
Sp100 C A 1: 85,682,264 probably benign Het
Spc24 G T 9: 21,757,390 L104I probably damaging Het
Surf4 T C 2: 26,933,313 N4D probably benign Het
Tas2r131 A T 6: 132,957,608 D79E probably benign Het
Tbrg1 T C 9: 37,654,991 probably benign Het
Tmem214 A G 5: 30,871,517 N150S probably damaging Het
Trappc13 A T 13: 104,150,098 I217K probably benign Het
Ttc41 T A 10: 86,736,977 C738S probably benign Het
Ttn T C 2: 76,709,724 Q25979R probably benign Het
Tubb2b A T 13: 34,128,197 N204K probably damaging Het
Ube3a T A 7: 59,288,488 M713K probably damaging Het
Usp37 T C 1: 74,495,811 probably benign Het
Vegfb T A 19: 6,982,846 *189C probably null Het
Vmn2r82 A G 10: 79,378,818 N212D probably benign Het
Vta1 A T 10: 14,668,122 probably null Het
Wdr66 A T 5: 123,322,572 Q225L probably benign Het
Xdh T G 17: 73,913,875 I620L possibly damaging Het
Xpnpep3 A G 15: 81,436,769 Y283C probably benign Het
Zscan18 A G 7: 12,770,864 S609P probably benign Het
Other mutations in Tbc1d20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02055:Tbc1d20 APN 2 152308058 missense probably damaging 0.99
IGL03111:Tbc1d20 APN 2 152308078 missense probably damaging 1.00
R0014:Tbc1d20 UTSW 2 152311781 missense probably benign 0.34
R2484:Tbc1d20 UTSW 2 152311363 missense probably damaging 1.00
R3683:Tbc1d20 UTSW 2 152311817 missense probably benign 0.05
R4352:Tbc1d20 UTSW 2 152308194 intron probably benign
R4815:Tbc1d20 UTSW 2 152311989 unclassified probably benign
R4908:Tbc1d20 UTSW 2 152302308 missense probably benign 0.08
R5010:Tbc1d20 UTSW 2 152293936 unclassified probably benign
R5800:Tbc1d20 UTSW 2 152308325 splice site probably null
R5832:Tbc1d20 UTSW 2 152311362 missense possibly damaging 0.93
R7193:Tbc1d20 UTSW 2 152311417 missense probably benign 0.01
R7346:Tbc1d20 UTSW 2 152304961 missense probably benign 0.02
R7705:Tbc1d20 UTSW 2 152308084 missense probably damaging 1.00
Z1177:Tbc1d20 UTSW 2 152308008 missense probably damaging 1.00
Z1177:Tbc1d20 UTSW 2 152308093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTGTCCAGTCTGGTGTC -3'
(R):5'- AAGACACTGAGCAGGCCATTG -3'

Sequencing Primer
(F):5'- CAGTCTGGTGTCTGATTCAAAGCC -3'
(R):5'- CAGCATGCTCTCTGGTAAAGATC -3'
Posted On2016-12-15