Incidental Mutation 'R5635:Fgg'
ID448636
Institutional Source Beutler Lab
Gene Symbol Fgg
Ensembl Gene ENSMUSG00000033860
Gene Namefibrinogen gamma chain
Synonymsgamma-fibrinogen, 3010002H13Rik
MMRRC Submission 043286-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R5635 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83007724-83015049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83011423 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 248 (T248A)
Ref Sequence ENSEMBL: ENSMUSP00000141648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048486] [ENSMUST00000194175]
Predicted Effect probably benign
Transcript: ENSMUST00000048486
AA Change: T248A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037018
Gene: ENSMUSG00000033860
AA Change: T248A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193581
Predicted Effect probably benign
Transcript: ENSMUST00000194175
AA Change: T248A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141648
Gene: ENSMUSG00000033860
AA Change: T248A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Fib_alpha 28 172 1.09e-72 SMART
FBG 173 414 6.77e-130 SMART
Meta Mutation Damage Score 0.0998 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Mice lacking the encoded protein did not possess detectable amounts of plasma fibrinogen. Pregnant mice lacking the encoded protein die due to heavy bleeding during delivery. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. Alternate splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Pregnant homozygous null mice exhibit retarded embryo-placental development, spontaneous abortion, and maternal death through excessive uterine bleeding. Mutants expressing a truncated polypeptide show reduced platelet aggregation, increased bleeding time, and occasional fatal neonatal bleeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,218,277 M53K possibly damaging Het
Aldh3b3 C T 19: 3,968,512 T409I probably benign Het
Ankrd13a C A 5: 114,801,717 H468Q possibly damaging Het
Ap2a1 A C 7: 44,923,901 probably benign Het
Arfgef1 A T 1: 10,188,860 S671T possibly damaging Het
C1ra G A 6: 124,516,724 C145Y probably damaging Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ccdc30 T C 4: 119,359,674 N123D possibly damaging Het
Cdc20 A T 4: 118,436,027 V232E possibly damaging Het
Cfap58 T A 19: 47,983,542 V637E possibly damaging Het
Coq4 T A 2: 29,788,355 V24E possibly damaging Het
Crim1 T A 17: 78,315,641 F423I probably damaging Het
Crls1 T C 2: 132,864,142 V262A possibly damaging Het
Crybb1 T C 5: 112,257,559 probably null Het
Cutc T A 19: 43,755,630 N23K probably benign Het
Cxcl10 T A 5: 92,347,839 I82F probably damaging Het
Cyp3a44 A T 5: 145,801,314 F60L possibly damaging Het
Dhx9 A G 1: 153,483,747 M35T probably benign Het
Dnah8 A G 17: 30,706,386 E1265G probably benign Het
Dzank1 C G 2: 144,483,407 D548H probably damaging Het
Eef2kmt A G 16: 5,249,029 V120A probably damaging Het
Elp4 A G 2: 105,814,264 probably null Het
Etl4 A T 2: 20,807,035 I1310F probably damaging Het
Exoc6b A T 6: 84,851,927 F492I probably damaging Het
F2rl2 A T 13: 95,700,782 I112F possibly damaging Het
Farp1 T A 14: 121,276,304 I837N possibly damaging Het
Fars2 A G 13: 36,410,146 E378G probably damaging Het
Flrt3 T A 2: 140,660,500 T403S probably damaging Het
Fndc3b C T 3: 27,541,931 E170K probably damaging Het
Gm17728 A G 17: 9,422,370 H104R probably benign Het
Hist2h2ab C A 3: 96,220,277 T121K possibly damaging Het
Hivep1 A G 13: 42,160,127 T1948A probably benign Het
Hspa4l T A 3: 40,745,745 I23N probably damaging Het
Ighv1-75 A G 12: 115,834,209 V31A probably benign Het
Kalrn T A 16: 34,014,084 N627I probably damaging Het
Lrp1b T G 2: 42,652,822 probably benign Het
Lrrc36 G A 8: 105,457,573 V480M probably damaging Het
Map4k3 A T 17: 80,613,495 N534K possibly damaging Het
Mybpc3 C T 2: 91,134,829 T1081I probably benign Het
Nfrkb T C 9: 31,399,298 S351P probably damaging Het
Nme4 A T 17: 26,094,231 V43E probably damaging Het
Notch1 C T 2: 26,476,161 E794K probably damaging Het
Nufip1 A T 14: 76,126,146 K270M probably damaging Het
Olfr1093 A G 2: 86,785,726 probably null Het
Olfr1330 G T 4: 118,893,635 G184V probably benign Het
Olfr390 G T 11: 73,787,634 R232L probably benign Het
Olfr65 G A 7: 103,906,638 M66I probably benign Het
Olfr919 A G 9: 38,698,159 I73T possibly damaging Het
Pcdhb15 T A 18: 37,473,770 Y18* probably null Het
Pcdhb21 A T 18: 37,513,917 Y33F probably benign Het
Pds5b T A 5: 150,778,221 H772Q possibly damaging Het
Pik3r4 C A 9: 105,667,825 H168N probably benign Het
Pitpnm3 A G 11: 72,067,160 S386P possibly damaging Het
Plg A G 17: 12,395,754 H307R probably damaging Het
Prdm9 A C 17: 15,562,440 D96E probably damaging Het
Prmt8 A G 6: 127,768,729 S7P probably damaging Het
Prune2 T C 19: 17,118,209 V359A probably benign Het
Pxn A T 5: 115,551,492 Q279L probably benign Het
Rarb A T 14: 16,443,788 C167S probably damaging Het
Rps6kb2 T A 19: 4,161,134 I131F probably damaging Het
Sec14l3 T A 11: 4,071,484 V219E probably damaging Het
Simc1 A G 13: 54,525,404 T522A probably benign Het
Slc1a6 T C 10: 78,789,091 V110A possibly damaging Het
Slc38a11 T G 2: 65,361,403 probably null Het
Snx13 T A 12: 35,140,171 D840E probably benign Het
Sp100 C A 1: 85,682,264 probably benign Het
Spc24 G T 9: 21,757,390 L104I probably damaging Het
Surf4 T C 2: 26,933,313 N4D probably benign Het
Tas2r131 A T 6: 132,957,608 D79E probably benign Het
Tbc1d20 T C 2: 152,311,461 S304P probably benign Het
Tbrg1 T C 9: 37,654,991 probably benign Het
Tmem214 A G 5: 30,871,517 N150S probably damaging Het
Trappc13 A T 13: 104,150,098 I217K probably benign Het
Ttc41 T A 10: 86,736,977 C738S probably benign Het
Ttn T C 2: 76,709,724 Q25979R probably benign Het
Tubb2b A T 13: 34,128,197 N204K probably damaging Het
Ube3a T A 7: 59,288,488 M713K probably damaging Het
Usp37 T C 1: 74,495,811 probably benign Het
Vegfb T A 19: 6,982,846 *189C probably null Het
Vmn2r82 A G 10: 79,378,818 N212D probably benign Het
Vta1 A T 10: 14,668,122 probably null Het
Wdr66 A T 5: 123,322,572 Q225L probably benign Het
Xdh T G 17: 73,913,875 I620L possibly damaging Het
Xpnpep3 A G 15: 81,436,769 Y283C probably benign Het
Zscan18 A G 7: 12,770,864 S609P probably benign Het
Other mutations in Fgg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Fgg APN 3 83014228 missense possibly damaging 0.67
IGL01713:Fgg APN 3 83008416 missense probably benign 0.20
IGL02288:Fgg APN 3 83008153 missense probably benign 0.11
IGL02994:Fgg APN 3 83008474 missense probably benign
PIT4519001:Fgg UTSW 3 83012939 missense probably damaging 1.00
R1251:Fgg UTSW 3 83012980 missense probably benign 0.03
R2137:Fgg UTSW 3 83008438 missense possibly damaging 0.78
R2400:Fgg UTSW 3 83008187 missense possibly damaging 0.94
R2436:Fgg UTSW 3 83014189 missense possibly damaging 0.94
R3429:Fgg UTSW 3 83012783 missense probably damaging 1.00
R4356:Fgg UTSW 3 83012943 missense probably damaging 1.00
R4612:Fgg UTSW 3 83010090 missense probably damaging 1.00
R4613:Fgg UTSW 3 83010090 missense probably damaging 1.00
R4828:Fgg UTSW 3 83008370 splice site probably benign
R4898:Fgg UTSW 3 83008540 missense probably benign 0.02
R4938:Fgg UTSW 3 83012868 missense probably benign 0.00
R4967:Fgg UTSW 3 83012765 missense probably benign 0.33
R5740:Fgg UTSW 3 83011525 missense probably benign 0.01
R6307:Fgg UTSW 3 83012976 missense probably damaging 0.98
R6731:Fgg UTSW 3 83012901 missense probably damaging 1.00
R6936:Fgg UTSW 3 83008420 missense possibly damaging 0.82
R7582:Fgg UTSW 3 83014138 missense probably damaging 1.00
R7769:Fgg UTSW 3 83013126 splice site probably null
R8258:Fgg UTSW 3 83010170 nonsense probably null
R8259:Fgg UTSW 3 83010170 nonsense probably null
R8290:Fgg UTSW 3 83012834 missense probably benign 0.00
R8810:Fgg UTSW 3 83013015 missense probably damaging 0.96
R8826:Fgg UTSW 3 83014318 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTTAGCTGGCAATTGGC -3'
(R):5'- GTTCACCACCAGCTGCAAAG -3'

Sequencing Primer
(F):5'- GCAATTGGCCGAATCATATCCTC -3'
(R):5'- GCTGCAAAGCTCCATTTAGC -3'
Posted On2016-12-15