Incidental Mutation 'R5635:Ccdc30'
ID448640
Institutional Source Beutler Lab
Gene Symbol Ccdc30
Ensembl Gene ENSMUSG00000028637
Gene Namecoiled-coil domain containing 30
Synonyms4930445I03Rik, 1700041C02Rik, 1700001O02Rik, 1700111D19Rik
MMRRC Submission 043286-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5635 (G1)
Quality Score205
Status Validated
Chromosome4
Chromosomal Location119322893-119415521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119359674 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 123 (N123D)
Ref Sequence ENSEMBL: ENSMUSP00000047534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044781] [ENSMUST00000063642] [ENSMUST00000143494]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044781
AA Change: N123D

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047534
Gene: ENSMUSG00000028637
AA Change: N123D

DomainStartEndE-ValueType
low complexity region 85 99 N/A INTRINSIC
Pfam:DUF4686 103 286 1.5e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063642
AA Change: N190D

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070621
Gene: ENSMUSG00000028637
AA Change: N190D

DomainStartEndE-ValueType
Pfam:DUF4686 170 547 5.1e-155 PFAM
low complexity region 555 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131141
Predicted Effect probably benign
Transcript: ENSMUST00000143494
AA Change: N51D

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118202
Gene: ENSMUSG00000028637
AA Change: N51D

DomainStartEndE-ValueType
Pfam:DUF4686 31 169 3.1e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154606
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,218,277 M53K possibly damaging Het
Aldh3b3 C T 19: 3,968,512 T409I probably benign Het
Ankrd13a C A 5: 114,801,717 H468Q possibly damaging Het
Ap2a1 A C 7: 44,923,901 probably benign Het
Arfgef1 A T 1: 10,188,860 S671T possibly damaging Het
C1ra G A 6: 124,516,724 C145Y probably damaging Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Cdc20 A T 4: 118,436,027 V232E possibly damaging Het
Cfap58 T A 19: 47,983,542 V637E possibly damaging Het
Coq4 T A 2: 29,788,355 V24E possibly damaging Het
Crim1 T A 17: 78,315,641 F423I probably damaging Het
Crls1 T C 2: 132,864,142 V262A possibly damaging Het
Crybb1 T C 5: 112,257,559 probably null Het
Cutc T A 19: 43,755,630 N23K probably benign Het
Cxcl10 T A 5: 92,347,839 I82F probably damaging Het
Cyp3a44 A T 5: 145,801,314 F60L possibly damaging Het
Dhx9 A G 1: 153,483,747 M35T probably benign Het
Dnah8 A G 17: 30,706,386 E1265G probably benign Het
Dzank1 C G 2: 144,483,407 D548H probably damaging Het
Eef2kmt A G 16: 5,249,029 V120A probably damaging Het
Elp4 A G 2: 105,814,264 probably null Het
Etl4 A T 2: 20,807,035 I1310F probably damaging Het
Exoc6b A T 6: 84,851,927 F492I probably damaging Het
F2rl2 A T 13: 95,700,782 I112F possibly damaging Het
Farp1 T A 14: 121,276,304 I837N possibly damaging Het
Fars2 A G 13: 36,410,146 E378G probably damaging Het
Fgg A G 3: 83,011,423 T248A probably benign Het
Flrt3 T A 2: 140,660,500 T403S probably damaging Het
Fndc3b C T 3: 27,541,931 E170K probably damaging Het
Gm17728 A G 17: 9,422,370 H104R probably benign Het
Hist2h2ab C A 3: 96,220,277 T121K possibly damaging Het
Hivep1 A G 13: 42,160,127 T1948A probably benign Het
Hspa4l T A 3: 40,745,745 I23N probably damaging Het
Ighv1-75 A G 12: 115,834,209 V31A probably benign Het
Kalrn T A 16: 34,014,084 N627I probably damaging Het
Lrp1b T G 2: 42,652,822 probably benign Het
Lrrc36 G A 8: 105,457,573 V480M probably damaging Het
Map4k3 A T 17: 80,613,495 N534K possibly damaging Het
Mybpc3 C T 2: 91,134,829 T1081I probably benign Het
Nfrkb T C 9: 31,399,298 S351P probably damaging Het
Nme4 A T 17: 26,094,231 V43E probably damaging Het
Notch1 C T 2: 26,476,161 E794K probably damaging Het
Nufip1 A T 14: 76,126,146 K270M probably damaging Het
Olfr1093 A G 2: 86,785,726 probably null Het
Olfr1330 G T 4: 118,893,635 G184V probably benign Het
Olfr390 G T 11: 73,787,634 R232L probably benign Het
Olfr65 G A 7: 103,906,638 M66I probably benign Het
Olfr919 A G 9: 38,698,159 I73T possibly damaging Het
Pcdhb15 T A 18: 37,473,770 Y18* probably null Het
Pcdhb21 A T 18: 37,513,917 Y33F probably benign Het
Pds5b T A 5: 150,778,221 H772Q possibly damaging Het
Pik3r4 C A 9: 105,667,825 H168N probably benign Het
Pitpnm3 A G 11: 72,067,160 S386P possibly damaging Het
Plg A G 17: 12,395,754 H307R probably damaging Het
Prdm9 A C 17: 15,562,440 D96E probably damaging Het
Prmt8 A G 6: 127,768,729 S7P probably damaging Het
Prune2 T C 19: 17,118,209 V359A probably benign Het
Pxn A T 5: 115,551,492 Q279L probably benign Het
Rarb A T 14: 16,443,788 C167S probably damaging Het
Rps6kb2 T A 19: 4,161,134 I131F probably damaging Het
Sec14l3 T A 11: 4,071,484 V219E probably damaging Het
Simc1 A G 13: 54,525,404 T522A probably benign Het
Slc1a6 T C 10: 78,789,091 V110A possibly damaging Het
Slc38a11 T G 2: 65,361,403 probably null Het
Snx13 T A 12: 35,140,171 D840E probably benign Het
Sp100 C A 1: 85,682,264 probably benign Het
Spc24 G T 9: 21,757,390 L104I probably damaging Het
Surf4 T C 2: 26,933,313 N4D probably benign Het
Tas2r131 A T 6: 132,957,608 D79E probably benign Het
Tbc1d20 T C 2: 152,311,461 S304P probably benign Het
Tbrg1 T C 9: 37,654,991 probably benign Het
Tmem214 A G 5: 30,871,517 N150S probably damaging Het
Trappc13 A T 13: 104,150,098 I217K probably benign Het
Ttc41 T A 10: 86,736,977 C738S probably benign Het
Ttn T C 2: 76,709,724 Q25979R probably benign Het
Tubb2b A T 13: 34,128,197 N204K probably damaging Het
Ube3a T A 7: 59,288,488 M713K probably damaging Het
Usp37 T C 1: 74,495,811 probably benign Het
Vegfb T A 19: 6,982,846 *189C probably null Het
Vmn2r82 A G 10: 79,378,818 N212D probably benign Het
Vta1 A T 10: 14,668,122 probably null Het
Wdr66 A T 5: 123,322,572 Q225L probably benign Het
Xdh T G 17: 73,913,875 I620L possibly damaging Het
Xpnpep3 A G 15: 81,436,769 Y283C probably benign Het
Zscan18 A G 7: 12,770,864 S609P probably benign Het
Other mutations in Ccdc30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Ccdc30 APN 4 119393579 missense possibly damaging 0.93
IGL01546:Ccdc30 APN 4 119398188 missense probably damaging 0.99
IGL01691:Ccdc30 APN 4 119393564 missense probably damaging 0.96
IGL02178:Ccdc30 APN 4 119349724 unclassified probably benign
IGL02341:Ccdc30 APN 4 119356781 missense possibly damaging 0.83
IGL03063:Ccdc30 APN 4 119349767 missense possibly damaging 0.68
IGL03394:Ccdc30 APN 4 119359582 missense probably damaging 1.00
G1patch:Ccdc30 UTSW 4 119331599 missense probably damaging 1.00
R1587:Ccdc30 UTSW 4 119353176 missense probably damaging 1.00
R1604:Ccdc30 UTSW 4 119331596 missense probably damaging 0.99
R1842:Ccdc30 UTSW 4 119331127 missense probably benign
R1962:Ccdc30 UTSW 4 119339791 missense probably benign 0.00
R2157:Ccdc30 UTSW 4 119333724 splice site probably benign
R2314:Ccdc30 UTSW 4 119324566 nonsense probably null
R2362:Ccdc30 UTSW 4 119324056 missense probably damaging 0.99
R3407:Ccdc30 UTSW 4 119324581 missense possibly damaging 0.63
R3755:Ccdc30 UTSW 4 119367808 critical splice donor site probably null
R3938:Ccdc30 UTSW 4 119352673 missense probably benign 0.02
R4762:Ccdc30 UTSW 4 119333588 missense probably damaging 0.98
R5014:Ccdc30 UTSW 4 119393627 missense possibly damaging 0.96
R6282:Ccdc30 UTSW 4 119324017 missense probably damaging 0.98
R6382:Ccdc30 UTSW 4 119404166 missense possibly damaging 0.93
R6725:Ccdc30 UTSW 4 119331599 missense probably damaging 1.00
R6746:Ccdc30 UTSW 4 119356718 missense probably benign 0.03
R7230:Ccdc30 UTSW 4 119339782 missense possibly damaging 0.89
R7576:Ccdc30 UTSW 4 119349866 missense probably damaging 1.00
R7673:Ccdc30 UTSW 4 119353172 missense probably damaging 1.00
R7719:Ccdc30 UTSW 4 119333616 missense probably damaging 1.00
R7895:Ccdc30 UTSW 4 119352713 splice site probably null
R8021:Ccdc30 UTSW 4 119352679 missense probably benign 0.00
R8113:Ccdc30 UTSW 4 119373746 missense probably benign 0.32
R8696:Ccdc30 UTSW 4 119377308 missense possibly damaging 0.92
R8713:Ccdc30 UTSW 4 119404207 missense probably damaging 0.99
R8885:Ccdc30 UTSW 4 119324562 missense probably damaging 0.97
R8948:Ccdc30 UTSW 4 119324161 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGGAGACTTGGCTCTCCC -3'
(R):5'- TTACAGGAGCACCACCATG -3'

Sequencing Primer
(F):5'- TGGCTCTCCCAAGCTGC -3'
(R):5'- CCATGCACGGTGTAGAAGCATC -3'
Posted On2016-12-15