Incidental Mutation 'R5635:Pxn'
ID448646
Institutional Source Beutler Lab
Gene Symbol Pxn
Ensembl Gene ENSMUSG00000029528
Gene Namepaxillin
SynonymsPax
MMRRC Submission 043286-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5635 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115506676-115555987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115551492 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 279 (Q279L)
Ref Sequence ENSEMBL: ENSMUSP00000083709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067268] [ENSMUST00000086523] [ENSMUST00000137716] [ENSMUST00000157050] [ENSMUST00000202564] [ENSMUST00000212819]
Predicted Effect probably benign
Transcript: ENSMUST00000067268
SMART Domains Protein: ENSMUSP00000069624
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 1.6e-98 PFAM
low complexity region 281 300 N/A INTRINSIC
LIM 323 374 3.99e-23 SMART
LIM 382 433 2.36e-16 SMART
LIM 441 492 8.16e-20 SMART
LIM 500 551 8.62e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086523
AA Change: Q279L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083709
Gene: ENSMUSG00000029528
AA Change: Q279L

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 4.8e-97 PFAM
low complexity region 315 334 N/A INTRINSIC
LIM 357 408 3.99e-23 SMART
LIM 416 467 2.36e-16 SMART
LIM 475 526 8.16e-20 SMART
LIM 534 585 8.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125054
Predicted Effect probably benign
Transcript: ENSMUST00000137716
SMART Domains Protein: ENSMUSP00000144513
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 1.9e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152156
Predicted Effect probably benign
Transcript: ENSMUST00000157050
SMART Domains Protein: ENSMUSP00000143926
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 106 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202564
SMART Domains Protein: ENSMUSP00000144459
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 5.8e-59 PFAM
low complexity region 148 167 N/A INTRINSIC
LIM 190 241 1.9e-25 SMART
LIM 249 300 1.1e-18 SMART
LIM 308 359 4e-22 SMART
LIM 367 418 4.4e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212819
Meta Mutation Damage Score 0.0804 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein involved in actin-membrane attachment at sites of cell adhesion to the extracellular matrix (focal adhesion). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. These isoforms exhibit different expression pattern, and have different biochemical, as well as physiological properties (PMID:9054445). [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice die at E9.5 with defects in the amnion, allantois, and headfold structures, as well as impaired growth, and abnormal heart and somite development; mutant fibroblasts show aberrant fibronectin-regulated focal adhesion dynamics, and disorganized membrane cytoskeletal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,218,277 M53K possibly damaging Het
Aldh3b3 C T 19: 3,968,512 T409I probably benign Het
Ankrd13a C A 5: 114,801,717 H468Q possibly damaging Het
Ap2a1 A C 7: 44,923,901 probably benign Het
Arfgef1 A T 1: 10,188,860 S671T possibly damaging Het
C1ra G A 6: 124,516,724 C145Y probably damaging Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ccdc30 T C 4: 119,359,674 N123D possibly damaging Het
Cdc20 A T 4: 118,436,027 V232E possibly damaging Het
Cfap58 T A 19: 47,983,542 V637E possibly damaging Het
Coq4 T A 2: 29,788,355 V24E possibly damaging Het
Crim1 T A 17: 78,315,641 F423I probably damaging Het
Crls1 T C 2: 132,864,142 V262A possibly damaging Het
Crybb1 T C 5: 112,257,559 probably null Het
Cutc T A 19: 43,755,630 N23K probably benign Het
Cxcl10 T A 5: 92,347,839 I82F probably damaging Het
Cyp3a44 A T 5: 145,801,314 F60L possibly damaging Het
Dhx9 A G 1: 153,483,747 M35T probably benign Het
Dnah8 A G 17: 30,706,386 E1265G probably benign Het
Dzank1 C G 2: 144,483,407 D548H probably damaging Het
Eef2kmt A G 16: 5,249,029 V120A probably damaging Het
Elp4 A G 2: 105,814,264 probably null Het
Etl4 A T 2: 20,807,035 I1310F probably damaging Het
Exoc6b A T 6: 84,851,927 F492I probably damaging Het
F2rl2 A T 13: 95,700,782 I112F possibly damaging Het
Farp1 T A 14: 121,276,304 I837N possibly damaging Het
Fars2 A G 13: 36,410,146 E378G probably damaging Het
Fgg A G 3: 83,011,423 T248A probably benign Het
Flrt3 T A 2: 140,660,500 T403S probably damaging Het
Fndc3b C T 3: 27,541,931 E170K probably damaging Het
Gm17728 A G 17: 9,422,370 H104R probably benign Het
Hist2h2ab C A 3: 96,220,277 T121K possibly damaging Het
Hivep1 A G 13: 42,160,127 T1948A probably benign Het
Hspa4l T A 3: 40,745,745 I23N probably damaging Het
Ighv1-75 A G 12: 115,834,209 V31A probably benign Het
Kalrn T A 16: 34,014,084 N627I probably damaging Het
Lrp1b T G 2: 42,652,822 probably benign Het
Lrrc36 G A 8: 105,457,573 V480M probably damaging Het
Map4k3 A T 17: 80,613,495 N534K possibly damaging Het
Mybpc3 C T 2: 91,134,829 T1081I probably benign Het
Nfrkb T C 9: 31,399,298 S351P probably damaging Het
Nme4 A T 17: 26,094,231 V43E probably damaging Het
Notch1 C T 2: 26,476,161 E794K probably damaging Het
Nufip1 A T 14: 76,126,146 K270M probably damaging Het
Olfr1093 A G 2: 86,785,726 probably null Het
Olfr1330 G T 4: 118,893,635 G184V probably benign Het
Olfr390 G T 11: 73,787,634 R232L probably benign Het
Olfr65 G A 7: 103,906,638 M66I probably benign Het
Olfr919 A G 9: 38,698,159 I73T possibly damaging Het
Pcdhb15 T A 18: 37,473,770 Y18* probably null Het
Pcdhb21 A T 18: 37,513,917 Y33F probably benign Het
Pds5b T A 5: 150,778,221 H772Q possibly damaging Het
Pik3r4 C A 9: 105,667,825 H168N probably benign Het
Pitpnm3 A G 11: 72,067,160 S386P possibly damaging Het
Plg A G 17: 12,395,754 H307R probably damaging Het
Prdm9 A C 17: 15,562,440 D96E probably damaging Het
Prmt8 A G 6: 127,768,729 S7P probably damaging Het
Prune2 T C 19: 17,118,209 V359A probably benign Het
Rarb A T 14: 16,443,788 C167S probably damaging Het
Rps6kb2 T A 19: 4,161,134 I131F probably damaging Het
Sec14l3 T A 11: 4,071,484 V219E probably damaging Het
Simc1 A G 13: 54,525,404 T522A probably benign Het
Slc1a6 T C 10: 78,789,091 V110A possibly damaging Het
Slc38a11 T G 2: 65,361,403 probably null Het
Snx13 T A 12: 35,140,171 D840E probably benign Het
Sp100 C A 1: 85,682,264 probably benign Het
Spc24 G T 9: 21,757,390 L104I probably damaging Het
Surf4 T C 2: 26,933,313 N4D probably benign Het
Tas2r131 A T 6: 132,957,608 D79E probably benign Het
Tbc1d20 T C 2: 152,311,461 S304P probably benign Het
Tbrg1 T C 9: 37,654,991 probably benign Het
Tmem214 A G 5: 30,871,517 N150S probably damaging Het
Trappc13 A T 13: 104,150,098 I217K probably benign Het
Ttc41 T A 10: 86,736,977 C738S probably benign Het
Ttn T C 2: 76,709,724 Q25979R probably benign Het
Tubb2b A T 13: 34,128,197 N204K probably damaging Het
Ube3a T A 7: 59,288,488 M713K probably damaging Het
Usp37 T C 1: 74,495,811 probably benign Het
Vegfb T A 19: 6,982,846 *189C probably null Het
Vmn2r82 A G 10: 79,378,818 N212D probably benign Het
Vta1 A T 10: 14,668,122 probably null Het
Wdr66 A T 5: 123,322,572 Q225L probably benign Het
Xdh T G 17: 73,913,875 I620L possibly damaging Het
Xpnpep3 A G 15: 81,436,769 Y283C probably benign Het
Zscan18 A G 7: 12,770,864 S609P probably benign Het
Other mutations in Pxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Pxn APN 5 115544926 missense probably benign 0.00
IGL02432:Pxn APN 5 115545746 missense probably damaging 1.00
IGL02454:Pxn APN 5 115552266 missense probably damaging 1.00
R0316:Pxn UTSW 5 115553968 missense probably damaging 1.00
R0778:Pxn UTSW 5 115552177 missense probably damaging 1.00
R1680:Pxn UTSW 5 115552147 missense probably damaging 1.00
R1874:Pxn UTSW 5 115544990 missense probably damaging 1.00
R2069:Pxn UTSW 5 115545667 missense probably benign 0.26
R2145:Pxn UTSW 5 115552756 unclassified probably benign
R4124:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4126:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4127:Pxn UTSW 5 115546907 missense probably damaging 1.00
R4551:Pxn UTSW 5 115552720 unclassified probably benign
R4717:Pxn UTSW 5 115551942 missense probably damaging 0.99
R5217:Pxn UTSW 5 115544915 missense probably benign 0.13
R5332:Pxn UTSW 5 115544369 missense probably damaging 1.00
R5681:Pxn UTSW 5 115544534 missense possibly damaging 0.94
R6629:Pxn UTSW 5 115554062 missense probably damaging 1.00
R6702:Pxn UTSW 5 115551896 missense probably benign 0.11
R7516:Pxn UTSW 5 115506863 missense unknown
R7671:Pxn UTSW 5 115548547 missense not run
R7749:Pxn UTSW 5 115548516 missense probably benign 0.00
R7866:Pxn UTSW 5 115548606 missense possibly damaging 0.85
R8196:Pxn UTSW 5 115545709 missense probably damaging 0.99
R8244:Pxn UTSW 5 115552243 missense probably damaging 1.00
X0018:Pxn UTSW 5 115545732 missense probably damaging 1.00
X0025:Pxn UTSW 5 115546895 missense probably damaging 0.97
X0065:Pxn UTSW 5 115551487 critical splice acceptor site probably null
Z1177:Pxn UTSW 5 115553893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGGGCCTCATGTCTAC -3'
(R):5'- CTTTCTATCCCGAACAGACAGGC -3'

Sequencing Primer
(F):5'- GCCTCATGTCTACCCGTGTGG -3'
(R):5'- ACATCGCAGGCAGTCCGAAG -3'
Posted On2016-12-15