Mutagenetix > Incidental Mutation

Incidental Mutation 'R5635:Exoc6b'

448651

Institutional Source

Beutler Lab

Gene Symbol

Exoc6b

Ensembl Gene

ENSMUSG00000033769

Gene Name

exocyst complex component 6B

Synonyms

Sec15b, Sec15l2, 4930569O18Rik, G430127E12Rik

MMRRC Submission

043286-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.820) question?

Stock #

R5635 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84618487-85069513 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84851927 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 492 (F492I)

Ref Sequence

ENSEMBL: ENSMUSP00000125312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160197] [ENSMUST00000162821]

AlphaFold

A6H5Z3

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000046334

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000051531

Predicted Effect

probably damaging
Transcript: ENSMUST00000160197
AA Change: F492I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125312
Gene: ENSMUSG00000033769
AA Change: F492I

Domain	Start	End	E-Value	Type
coiled coil region	79	118	N/A	INTRINSIC
low complexity region	272	282	N/A	INTRINSIC
Pfam:Sec15	464	770	4.5e-105	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162821

Meta Mutation Damage Score

0.3628

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a part of the evolutionarily conserved exocyst, a multimeric protein complex necessary for exocytosis, which in turn, is crucial for cell growth, polarity and migration. Disruption of this gene may be associated with phenotypes exhibiting multiple symptoms including intellectual disability and developmental delay (DD). [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	T	A	10: 29,218,277	M53K	possibly damaging	Het
Aldh3b3	C	T	19: 3,968,512	T409I	probably benign	Het
Ankrd13a	C	A	5: 114,801,717	H468Q	possibly damaging	Het
Ap2a1	A	C	7: 44,923,901		probably benign	Het
Arfgef1	A	T	1: 10,188,860	S671T	possibly damaging	Het
C1ra	G	A	6: 124,516,724	C145Y	probably damaging	Het
Catsperd	G	A	17: 56,632,335	V55M	possibly damaging	Het
Ccdc30	T	C	4: 119,359,674	N123D	possibly damaging	Het
Cdc20	A	T	4: 118,436,027	V232E	possibly damaging	Het
Cfap58	T	A	19: 47,983,542	V637E	possibly damaging	Het
Coq4	T	A	2: 29,788,355	V24E	possibly damaging	Het
Crim1	T	A	17: 78,315,641	F423I	probably damaging	Het
Crls1	T	C	2: 132,864,142	V262A	possibly damaging	Het
Crybb1	T	C	5: 112,257,559		probably null	Het
Cutc	T	A	19: 43,755,630	N23K	probably benign	Het
Cxcl10	T	A	5: 92,347,839	I82F	probably damaging	Het
Cyp3a44	A	T	5: 145,801,314	F60L	possibly damaging	Het
Dhx9	A	G	1: 153,483,747	M35T	probably benign	Het
Dnah8	A	G	17: 30,706,386	E1265G	probably benign	Het
Dzank1	C	G	2: 144,483,407	D548H	probably damaging	Het
Eef2kmt	A	G	16: 5,249,029	V120A	probably damaging	Het
Elp4	A	G	2: 105,814,264		probably null	Het
Etl4	A	T	2: 20,807,035	I1310F	probably damaging	Het
F2rl2	A	T	13: 95,700,782	I112F	possibly damaging	Het
Farp1	T	A	14: 121,276,304	I837N	possibly damaging	Het
Fars2	A	G	13: 36,410,146	E378G	probably damaging	Het
Fgg	A	G	3: 83,011,423	T248A	probably benign	Het
Flrt3	T	A	2: 140,660,500	T403S	probably damaging	Het
Fndc3b	C	T	3: 27,541,931	E170K	probably damaging	Het
Gm17728	A	G	17: 9,422,370	H104R	probably benign	Het
Hist2h2ab	C	A	3: 96,220,277	T121K	possibly damaging	Het
Hivep1	A	G	13: 42,160,127	T1948A	probably benign	Het
Hspa4l	T	A	3: 40,745,745	I23N	probably damaging	Het
Ighv1-75	A	G	12: 115,834,209	V31A	probably benign	Het
Kalrn	T	A	16: 34,014,084	N627I	probably damaging	Het
Lrp1b	T	G	2: 42,652,822		probably benign	Het
Lrrc36	G	A	8: 105,457,573	V480M	probably damaging	Het
Map4k3	A	T	17: 80,613,495	N534K	possibly damaging	Het
Mybpc3	C	T	2: 91,134,829	T1081I	probably benign	Het
Nfrkb	T	C	9: 31,399,298	S351P	probably damaging	Het
Nme4	A	T	17: 26,094,231	V43E	probably damaging	Het
Notch1	C	T	2: 26,476,161	E794K	probably damaging	Het
Nufip1	A	T	14: 76,126,146	K270M	probably damaging	Het
Olfr1093	A	G	2: 86,785,726		probably null	Het
Olfr1330	G	T	4: 118,893,635	G184V	probably benign	Het
Olfr390	G	T	11: 73,787,634	R232L	probably benign	Het
Olfr65	G	A	7: 103,906,638	M66I	probably benign	Het
Olfr919	A	G	9: 38,698,159	I73T	possibly damaging	Het
Pcdhb15	T	A	18: 37,473,770	Y18*	probably null	Het
Pcdhb21	A	T	18: 37,513,917	Y33F	probably benign	Het
Pds5b	T	A	5: 150,778,221	H772Q	possibly damaging	Het
Pik3r4	C	A	9: 105,667,825	H168N	probably benign	Het
Pitpnm3	A	G	11: 72,067,160	S386P	possibly damaging	Het
Plg	A	G	17: 12,395,754	H307R	probably damaging	Het
Prdm9	A	C	17: 15,562,440	D96E	probably damaging	Het
Prmt8	A	G	6: 127,768,729	S7P	probably damaging	Het
Prune2	T	C	19: 17,118,209	V359A	probably benign	Het
Pxn	A	T	5: 115,551,492	Q279L	probably benign	Het
Rarb	A	T	14: 16,443,788	C167S	probably damaging	Het
Rps6kb2	T	A	19: 4,161,134	I131F	probably damaging	Het
Sec14l3	T	A	11: 4,071,484	V219E	probably damaging	Het
Simc1	A	G	13: 54,525,404	T522A	probably benign	Het
Slc1a6	T	C	10: 78,789,091	V110A	possibly damaging	Het
Slc38a11	T	G	2: 65,361,403		probably null	Het
Snx13	T	A	12: 35,140,171	D840E	probably benign	Het
Sp100	C	A	1: 85,682,264		probably benign	Het
Spc24	G	T	9: 21,757,390	L104I	probably damaging	Het
Surf4	T	C	2: 26,933,313	N4D	probably benign	Het
Tas2r131	A	T	6: 132,957,608	D79E	probably benign	Het
Tbc1d20	T	C	2: 152,311,461	S304P	probably benign	Het
Tbrg1	T	C	9: 37,654,991		probably benign	Het
Tmem214	A	G	5: 30,871,517	N150S	probably damaging	Het
Trappc13	A	T	13: 104,150,098	I217K	probably benign	Het
Ttc41	T	A	10: 86,736,977	C738S	probably benign	Het
Ttn	T	C	2: 76,709,724	Q25979R	probably benign	Het
Tubb2b	A	T	13: 34,128,197	N204K	probably damaging	Het
Ube3a	T	A	7: 59,288,488	M713K	probably damaging	Het
Usp37	T	C	1: 74,495,811		probably benign	Het
Vegfb	T	A	19: 6,982,846	*189C	probably null	Het
Vmn2r82	A	G	10: 79,378,818	N212D	probably benign	Het
Vta1	A	T	10: 14,668,122		probably null	Het
Wdr66	A	T	5: 123,322,572	Q225L	probably benign	Het
Xdh	T	G	17: 73,913,875	I620L	possibly damaging	Het
Xpnpep3	A	G	15: 81,436,769	Y283C	probably benign	Het
Zscan18	A	G	7: 12,770,864	S609P	probably benign	Het

Other mutations in Exoc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Exoc6b	APN	6	84989453	missense	probably benign	0.08
IGL01148:Exoc6b	APN	6	84908226	missense	probably benign	0.18
IGL01804:Exoc6b	APN	6	84908166	missense	probably damaging	0.98
IGL01817:Exoc6b	APN	6	85069338	missense	probably damaging	1.00
IGL01912:Exoc6b	APN	6	84625174	missense	probably damaging	1.00
IGL02441:Exoc6b	APN	6	85005008	missense	probably damaging	1.00
IGL02947:Exoc6b	APN	6	84858429	missense	probably benign
IGL02996:Exoc6b	APN	6	84908213	missense	probably benign	0.01
IGL03132:Exoc6b	APN	6	84791264	missense	possibly damaging	0.46
IGL03338:Exoc6b	APN	6	84844130	missense	probably damaging	0.99
R0003:Exoc6b	UTSW	6	84854699	critical splice donor site	probably null
R0732:Exoc6b	UTSW	6	84855522	missense	probably damaging	0.99
R1137:Exoc6b	UTSW	6	84908223	missense	probably benign
R1381:Exoc6b	UTSW	6	84835117	missense	probably benign
R1723:Exoc6b	UTSW	6	85069344	missense	probably damaging	1.00
R1838:Exoc6b	UTSW	6	84853678	missense	probably benign	0.04
R1866:Exoc6b	UTSW	6	84851914	missense	probably damaging	0.99
R2122:Exoc6b	UTSW	6	84621482	missense	probably benign	0.01
R2138:Exoc6b	UTSW	6	84989482	missense	probably damaging	1.00
R2357:Exoc6b	UTSW	6	84989339	missense	possibly damaging	0.60
R2987:Exoc6b	UTSW	6	84851947	missense	probably damaging	0.96
R2988:Exoc6b	UTSW	6	84851947	missense	probably damaging	0.96
R3415:Exoc6b	UTSW	6	84890565	missense	possibly damaging	0.81
R3417:Exoc6b	UTSW	6	84890565	missense	possibly damaging	0.81
R4364:Exoc6b	UTSW	6	85003179	intron	probably benign
R4610:Exoc6b	UTSW	6	85003159	intron	probably benign
R4624:Exoc6b	UTSW	6	84854809	splice site	probably benign
R4845:Exoc6b	UTSW	6	84835137	missense	probably benign	0.04
R5366:Exoc6b	UTSW	6	84890531	missense	probably benign
R5603:Exoc6b	UTSW	6	84835144	missense	possibly damaging	0.96
R5728:Exoc6b	UTSW	6	84860191	missense	probably damaging	1.00
R6188:Exoc6b	UTSW	6	84855497	missense	probably damaging	0.99
R7030:Exoc6b	UTSW	6	84848825	missense	probably damaging	0.99
R7058:Exoc6b	UTSW	6	84854722	missense	probably damaging	1.00
R7259:Exoc6b	UTSW	6	84848810	missense	probably benign	0.40
R7574:Exoc6b	UTSW	6	84791384	critical splice acceptor site	probably null
R7607:Exoc6b	UTSW	6	84989409	missense	possibly damaging	0.67
R7918:Exoc6b	UTSW	6	85069350	missense	probably damaging	0.96
R8146:Exoc6b	UTSW	6	84908194	missense	probably benign	0.00
R8204:Exoc6b	UTSW	6	84855522	missense	probably damaging	1.00
R8356:Exoc6b	UTSW	6	84844095	frame shift	probably null
R8456:Exoc6b	UTSW	6	84844095	frame shift	probably null
R9099:Exoc6b	UTSW	6	85005018	missense	possibly damaging	0.88
R9608:Exoc6b	UTSW	6	84625124	critical splice donor site	probably null
R9620:Exoc6b	UTSW	6	85011320	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGTGAAAGCCTATTCCAAAGTTCC -3'
(R):5'- GTCAATACTTTACAGGGTAGGACAAAG -3'

Sequencing Primer
(F):5'- GTTCCAAACTCATAGCAAAGACTTTC -3'
(R):5'- AGAGAGGCCCTTTAGACTTGC -3'

Posted On

2016-12-15