Mutagenetix > Incidental Mutation

Incidental Mutation 'R5635:Ube3a'

448656

Institutional Source

Beutler Lab

Gene Symbol

Ube3a

Ensembl Gene

ENSMUSG00000025326

Gene Name

ubiquitin protein ligase E3A

Synonyms

Hpve6a, 5830462N02Rik, E6-AP ubiquitin protein ligase, A130086L21Rik

MMRRC Submission

043286-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.682) question?

Stock #

R5635 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59228750-59311536 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59288488 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 713 (M713K)

Ref Sequence

ENSEMBL: ENSMUSP00000143962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107537] [ENSMUST00000200758] [ENSMUST00000202945]

AlphaFold

O08759

Predicted Effect

probably damaging
Transcript: ENSMUST00000107537
AA Change: M713K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103161
Gene: ENSMUSG00000025326
AA Change: M713K

Domain	Start	End	E-Value	Type
Pfam:AZUL	27	81	1.7e-21	PFAM
Blast:HECTc	108	169	2e-20	BLAST
low complexity region	170	207	N/A	INTRINSIC
Blast:HECTc	359	480	1e-12	BLAST
HECTc	540	870	5.05e-180	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000200758
AA Change: M734K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143859
Gene: ENSMUSG00000025326
AA Change: M734K

Domain	Start	End	E-Value	Type
Pfam:AZUL	27	81	1.7e-21	PFAM
Blast:HECTc	108	169	2e-20	BLAST
low complexity region	170	207	N/A	INTRINSIC
Blast:HECTc	359	480	1e-12	BLAST
HECTc	540	870	5.05e-180	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202207

Predicted Effect

unknown
Transcript: ENSMUST00000202247
AA Change: M55K

Predicted Effect

probably benign
Transcript: ENSMUST00000202288

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202776

Predicted Effect

probably damaging
Transcript: ENSMUST00000202945
AA Change: M713K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143962
Gene: ENSMUSG00000025326
AA Change: M713K

Domain	Start	End	E-Value	Type
Pfam:AZUL	6	60	4.4e-21	PFAM
Blast:HECTc	87	148	2e-20	BLAST
low complexity region	149	186	N/A	INTRINSIC
Blast:HECTc	338	459	1e-12	BLAST
HECTc	519	762	7.07e-79	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207667

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207816

Meta Mutation Damage Score

0.4746

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with maternally inherited targeted null mutations exhibit reduced brain weight, impaired motor function, inducible seizures, learning deficits, abnormal hippocampal electroencephalographic recordings, and severely impaired long-term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	T	A	10: 29,218,277	M53K	possibly damaging	Het
Aldh3b3	C	T	19: 3,968,512	T409I	probably benign	Het
Ankrd13a	C	A	5: 114,801,717	H468Q	possibly damaging	Het
Ap2a1	A	C	7: 44,923,901		probably benign	Het
Arfgef1	A	T	1: 10,188,860	S671T	possibly damaging	Het
C1ra	G	A	6: 124,516,724	C145Y	probably damaging	Het
Catsperd	G	A	17: 56,632,335	V55M	possibly damaging	Het
Ccdc30	T	C	4: 119,359,674	N123D	possibly damaging	Het
Cdc20	A	T	4: 118,436,027	V232E	possibly damaging	Het
Cfap58	T	A	19: 47,983,542	V637E	possibly damaging	Het
Coq4	T	A	2: 29,788,355	V24E	possibly damaging	Het
Crim1	T	A	17: 78,315,641	F423I	probably damaging	Het
Crls1	T	C	2: 132,864,142	V262A	possibly damaging	Het
Crybb1	T	C	5: 112,257,559		probably null	Het
Cutc	T	A	19: 43,755,630	N23K	probably benign	Het
Cxcl10	T	A	5: 92,347,839	I82F	probably damaging	Het
Cyp3a44	A	T	5: 145,801,314	F60L	possibly damaging	Het
Dhx9	A	G	1: 153,483,747	M35T	probably benign	Het
Dnah8	A	G	17: 30,706,386	E1265G	probably benign	Het
Dzank1	C	G	2: 144,483,407	D548H	probably damaging	Het
Eef2kmt	A	G	16: 5,249,029	V120A	probably damaging	Het
Elp4	A	G	2: 105,814,264		probably null	Het
Etl4	A	T	2: 20,807,035	I1310F	probably damaging	Het
Exoc6b	A	T	6: 84,851,927	F492I	probably damaging	Het
F2rl2	A	T	13: 95,700,782	I112F	possibly damaging	Het
Farp1	T	A	14: 121,276,304	I837N	possibly damaging	Het
Fars2	A	G	13: 36,410,146	E378G	probably damaging	Het
Fgg	A	G	3: 83,011,423	T248A	probably benign	Het
Flrt3	T	A	2: 140,660,500	T403S	probably damaging	Het
Fndc3b	C	T	3: 27,541,931	E170K	probably damaging	Het
Gm17728	A	G	17: 9,422,370	H104R	probably benign	Het
Hist2h2ab	C	A	3: 96,220,277	T121K	possibly damaging	Het
Hivep1	A	G	13: 42,160,127	T1948A	probably benign	Het
Hspa4l	T	A	3: 40,745,745	I23N	probably damaging	Het
Ighv1-75	A	G	12: 115,834,209	V31A	probably benign	Het
Kalrn	T	A	16: 34,014,084	N627I	probably damaging	Het
Lrp1b	T	G	2: 42,652,822		probably benign	Het
Lrrc36	G	A	8: 105,457,573	V480M	probably damaging	Het
Map4k3	A	T	17: 80,613,495	N534K	possibly damaging	Het
Mybpc3	C	T	2: 91,134,829	T1081I	probably benign	Het
Nfrkb	T	C	9: 31,399,298	S351P	probably damaging	Het
Nme4	A	T	17: 26,094,231	V43E	probably damaging	Het
Notch1	C	T	2: 26,476,161	E794K	probably damaging	Het
Nufip1	A	T	14: 76,126,146	K270M	probably damaging	Het
Olfr1093	A	G	2: 86,785,726		probably null	Het
Olfr1330	G	T	4: 118,893,635	G184V	probably benign	Het
Olfr390	G	T	11: 73,787,634	R232L	probably benign	Het
Olfr65	G	A	7: 103,906,638	M66I	probably benign	Het
Olfr919	A	G	9: 38,698,159	I73T	possibly damaging	Het
Pcdhb15	T	A	18: 37,473,770	Y18*	probably null	Het
Pcdhb21	A	T	18: 37,513,917	Y33F	probably benign	Het
Pds5b	T	A	5: 150,778,221	H772Q	possibly damaging	Het
Pik3r4	C	A	9: 105,667,825	H168N	probably benign	Het
Pitpnm3	A	G	11: 72,067,160	S386P	possibly damaging	Het
Plg	A	G	17: 12,395,754	H307R	probably damaging	Het
Prdm9	A	C	17: 15,562,440	D96E	probably damaging	Het
Prmt8	A	G	6: 127,768,729	S7P	probably damaging	Het
Prune2	T	C	19: 17,118,209	V359A	probably benign	Het
Pxn	A	T	5: 115,551,492	Q279L	probably benign	Het
Rarb	A	T	14: 16,443,788	C167S	probably damaging	Het
Rps6kb2	T	A	19: 4,161,134	I131F	probably damaging	Het
Sec14l3	T	A	11: 4,071,484	V219E	probably damaging	Het
Simc1	A	G	13: 54,525,404	T522A	probably benign	Het
Slc1a6	T	C	10: 78,789,091	V110A	possibly damaging	Het
Slc38a11	T	G	2: 65,361,403		probably null	Het
Snx13	T	A	12: 35,140,171	D840E	probably benign	Het
Sp100	C	A	1: 85,682,264		probably benign	Het
Spc24	G	T	9: 21,757,390	L104I	probably damaging	Het
Surf4	T	C	2: 26,933,313	N4D	probably benign	Het
Tas2r131	A	T	6: 132,957,608	D79E	probably benign	Het
Tbc1d20	T	C	2: 152,311,461	S304P	probably benign	Het
Tbrg1	T	C	9: 37,654,991		probably benign	Het
Tmem214	A	G	5: 30,871,517	N150S	probably damaging	Het
Trappc13	A	T	13: 104,150,098	I217K	probably benign	Het
Ttc41	T	A	10: 86,736,977	C738S	probably benign	Het
Ttn	T	C	2: 76,709,724	Q25979R	probably benign	Het
Tubb2b	A	T	13: 34,128,197	N204K	probably damaging	Het
Usp37	T	C	1: 74,495,811		probably benign	Het
Vegfb	T	A	19: 6,982,846	*189C	probably null	Het
Vmn2r82	A	G	10: 79,378,818	N212D	probably benign	Het
Vta1	A	T	10: 14,668,122		probably null	Het
Wdr66	A	T	5: 123,322,572	Q225L	probably benign	Het
Xdh	T	G	17: 73,913,875	I620L	possibly damaging	Het
Xpnpep3	A	G	15: 81,436,769	Y283C	probably benign	Het
Zscan18	A	G	7: 12,770,864	S609P	probably benign	Het

Other mutations in Ube3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Ube3a	APN	7	59272110	missense	probably damaging	1.00
IGL00886:Ube3a	APN	7	59284737	missense	probably damaging	1.00
IGL02037:Ube3a	APN	7	59275758	unclassified	probably benign
IGL02127:Ube3a	APN	7	59276041	missense	probably benign	0.03
IGL02228:Ube3a	APN	7	59288396	splice site	probably benign
IGL02533:Ube3a	APN	7	59304832	missense	probably damaging	1.00
IGL02706:Ube3a	APN	7	59272133	missense	possibly damaging	0.67
IGL03037:Ube3a	APN	7	59247223	splice site	probably benign
IGL03213:Ube3a	APN	7	59286122	nonsense	probably null
IGL03306:Ube3a	APN	7	59286147	missense	probably damaging	1.00
Kebab	UTSW	7	59288488	missense	probably damaging	1.00
Shawarma	UTSW	7	59276183	nonsense	probably null
PIT4362001:Ube3a	UTSW	7	59276122	missense	possibly damaging	0.86
R0847:Ube3a	UTSW	7	59276586	missense	possibly damaging	0.80
R1765:Ube3a	UTSW	7	59286114	missense	probably damaging	1.00
R1771:Ube3a	UTSW	7	59275966	missense	probably damaging	1.00
R1926:Ube3a	UTSW	7	59276379	missense	probably damaging	1.00
R1992:Ube3a	UTSW	7	59303787	missense	probably damaging	1.00
R2026:Ube3a	UTSW	7	59303726	missense	probably damaging	1.00
R2104:Ube3a	UTSW	7	59276477	missense	possibly damaging	0.95
R3176:Ube3a	UTSW	7	59276519	nonsense	probably null
R3276:Ube3a	UTSW	7	59276519	nonsense	probably null
R3623:Ube3a	UTSW	7	59272112	missense	probably damaging	1.00
R3624:Ube3a	UTSW	7	59272112	missense	probably damaging	1.00
R3690:Ube3a	UTSW	7	59276799	missense	probably damaging	1.00
R4423:Ube3a	UTSW	7	59276113	missense	probably benign	0.10
R4583:Ube3a	UTSW	7	59286063	missense	probably damaging	1.00
R4883:Ube3a	UTSW	7	59243450	start codon destroyed	probably benign	0.21
R4992:Ube3a	UTSW	7	59284820	missense	possibly damaging	0.47
R5175:Ube3a	UTSW	7	59288717	missense	probably damaging	1.00
R5397:Ube3a	UTSW	7	59286912	missense	probably benign	0.26
R5545:Ube3a	UTSW	7	59272024	missense	probably damaging	1.00
R5572:Ube3a	UTSW	7	59288777	missense	probably damaging	1.00
R5766:Ube3a	UTSW	7	59276059	missense	possibly damaging	0.89
R5890:Ube3a	UTSW	7	59272028	missense	probably damaging	1.00
R5956:Ube3a	UTSW	7	59277020	unclassified	probably benign
R6388:Ube3a	UTSW	7	59304921	splice site	probably null
R6464:Ube3a	UTSW	7	59276183	nonsense	probably null
R6467:Ube3a	UTSW	7	59276902	missense	probably damaging	1.00
R6474:Ube3a	UTSW	7	59287024	missense	probably damaging	1.00
R6669:Ube3a	UTSW	7	59276857	missense	probably benign	0.02
R7003:Ube3a	UTSW	7	59276440	missense	probably damaging	1.00
R7044:Ube3a	UTSW	7	59288413	missense	probably damaging	1.00
R7187:Ube3a	UTSW	7	59275905	missense	probably benign	0.02
R7360:Ube3a	UTSW	7	59276635	missense	probably damaging	1.00
R7363:Ube3a	UTSW	7	59287003	missense	probably benign	0.00
R7508:Ube3a	UTSW	7	59303689	missense	possibly damaging	0.84
R7652:Ube3a	UTSW	7	59243354	start gained	probably benign
R7768:Ube3a	UTSW	7	59288777	missense	probably damaging	1.00
R8015:Ube3a	UTSW	7	59284756	missense	probably damaging	1.00
R8044:Ube3a	UTSW	7	59276572	missense	possibly damaging	0.51
R8476:Ube3a	UTSW	7	59304827	missense	probably damaging	1.00
R9394:Ube3a	UTSW	7	59272212	nonsense	probably null
R9404:Ube3a	UTSW	7	59287015	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAATACTGCTGAAGGTTTTCTTGGG -3'
(R):5'- GCCACCGTCATACTCTGTAG -3'

Sequencing Primer
(F):5'- GGTGGAGGGTGGGTATTAAAACTAG -3'
(R):5'- CTAGTGCCTGGAAATCTAGATTCTG -3'

Posted On

2016-12-15