Incidental Mutation 'R5635:Pik3r4'
ID448662
Institutional Source Beutler Lab
Gene Symbol Pik3r4
Ensembl Gene ENSMUSG00000032571
Gene Namephosphoinositide-3-kinase regulatory subunit 4
SynonymsD9Ertd418e, 2210010O15Rik, C730038E05Rik
MMRRC Submission 043286-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5635 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105642978-105687657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105667825 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 168 (H168N)
Ref Sequence ENSEMBL: ENSMUSP00000140311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000186943] [ENSMUST00000191268]
Predicted Effect probably benign
Transcript: ENSMUST00000065778
AA Change: H809N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: H809N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 1.7e-5 PFAM
Pfam:Pkinase 26 312 1.2e-18 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186943
AA Change: H168N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188385
Predicted Effect probably benign
Transcript: ENSMUST00000191268
AA Change: H809N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: H809N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 8.9e-7 PFAM
Pfam:Pkinase 26 312 3.7e-23 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Meta Mutation Damage Score 0.0845 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,218,277 M53K possibly damaging Het
Aldh3b3 C T 19: 3,968,512 T409I probably benign Het
Ankrd13a C A 5: 114,801,717 H468Q possibly damaging Het
Ap2a1 A C 7: 44,923,901 probably benign Het
Arfgef1 A T 1: 10,188,860 S671T possibly damaging Het
C1ra G A 6: 124,516,724 C145Y probably damaging Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ccdc30 T C 4: 119,359,674 N123D possibly damaging Het
Cdc20 A T 4: 118,436,027 V232E possibly damaging Het
Cfap58 T A 19: 47,983,542 V637E possibly damaging Het
Coq4 T A 2: 29,788,355 V24E possibly damaging Het
Crim1 T A 17: 78,315,641 F423I probably damaging Het
Crls1 T C 2: 132,864,142 V262A possibly damaging Het
Crybb1 T C 5: 112,257,559 probably null Het
Cutc T A 19: 43,755,630 N23K probably benign Het
Cxcl10 T A 5: 92,347,839 I82F probably damaging Het
Cyp3a44 A T 5: 145,801,314 F60L possibly damaging Het
Dhx9 A G 1: 153,483,747 M35T probably benign Het
Dnah8 A G 17: 30,706,386 E1265G probably benign Het
Dzank1 C G 2: 144,483,407 D548H probably damaging Het
Eef2kmt A G 16: 5,249,029 V120A probably damaging Het
Elp4 A G 2: 105,814,264 probably null Het
Etl4 A T 2: 20,807,035 I1310F probably damaging Het
Exoc6b A T 6: 84,851,927 F492I probably damaging Het
F2rl2 A T 13: 95,700,782 I112F possibly damaging Het
Farp1 T A 14: 121,276,304 I837N possibly damaging Het
Fars2 A G 13: 36,410,146 E378G probably damaging Het
Fgg A G 3: 83,011,423 T248A probably benign Het
Flrt3 T A 2: 140,660,500 T403S probably damaging Het
Fndc3b C T 3: 27,541,931 E170K probably damaging Het
Gm17728 A G 17: 9,422,370 H104R probably benign Het
Hist2h2ab C A 3: 96,220,277 T121K possibly damaging Het
Hivep1 A G 13: 42,160,127 T1948A probably benign Het
Hspa4l T A 3: 40,745,745 I23N probably damaging Het
Ighv1-75 A G 12: 115,834,209 V31A probably benign Het
Kalrn T A 16: 34,014,084 N627I probably damaging Het
Lrp1b T G 2: 42,652,822 probably benign Het
Lrrc36 G A 8: 105,457,573 V480M probably damaging Het
Map4k3 A T 17: 80,613,495 N534K possibly damaging Het
Mybpc3 C T 2: 91,134,829 T1081I probably benign Het
Nfrkb T C 9: 31,399,298 S351P probably damaging Het
Nme4 A T 17: 26,094,231 V43E probably damaging Het
Notch1 C T 2: 26,476,161 E794K probably damaging Het
Nufip1 A T 14: 76,126,146 K270M probably damaging Het
Olfr1093 A G 2: 86,785,726 probably null Het
Olfr1330 G T 4: 118,893,635 G184V probably benign Het
Olfr390 G T 11: 73,787,634 R232L probably benign Het
Olfr65 G A 7: 103,906,638 M66I probably benign Het
Olfr919 A G 9: 38,698,159 I73T possibly damaging Het
Pcdhb15 T A 18: 37,473,770 Y18* probably null Het
Pcdhb21 A T 18: 37,513,917 Y33F probably benign Het
Pds5b T A 5: 150,778,221 H772Q possibly damaging Het
Pitpnm3 A G 11: 72,067,160 S386P possibly damaging Het
Plg A G 17: 12,395,754 H307R probably damaging Het
Prdm9 A C 17: 15,562,440 D96E probably damaging Het
Prmt8 A G 6: 127,768,729 S7P probably damaging Het
Prune2 T C 19: 17,118,209 V359A probably benign Het
Pxn A T 5: 115,551,492 Q279L probably benign Het
Rarb A T 14: 16,443,788 C167S probably damaging Het
Rps6kb2 T A 19: 4,161,134 I131F probably damaging Het
Sec14l3 T A 11: 4,071,484 V219E probably damaging Het
Simc1 A G 13: 54,525,404 T522A probably benign Het
Slc1a6 T C 10: 78,789,091 V110A possibly damaging Het
Slc38a11 T G 2: 65,361,403 probably null Het
Snx13 T A 12: 35,140,171 D840E probably benign Het
Sp100 C A 1: 85,682,264 probably benign Het
Spc24 G T 9: 21,757,390 L104I probably damaging Het
Surf4 T C 2: 26,933,313 N4D probably benign Het
Tas2r131 A T 6: 132,957,608 D79E probably benign Het
Tbc1d20 T C 2: 152,311,461 S304P probably benign Het
Tbrg1 T C 9: 37,654,991 probably benign Het
Tmem214 A G 5: 30,871,517 N150S probably damaging Het
Trappc13 A T 13: 104,150,098 I217K probably benign Het
Ttc41 T A 10: 86,736,977 C738S probably benign Het
Ttn T C 2: 76,709,724 Q25979R probably benign Het
Tubb2b A T 13: 34,128,197 N204K probably damaging Het
Ube3a T A 7: 59,288,488 M713K probably damaging Het
Usp37 T C 1: 74,495,811 probably benign Het
Vegfb T A 19: 6,982,846 *189C probably null Het
Vmn2r82 A G 10: 79,378,818 N212D probably benign Het
Vta1 A T 10: 14,668,122 probably null Het
Wdr66 A T 5: 123,322,572 Q225L probably benign Het
Xdh T G 17: 73,913,875 I620L possibly damaging Het
Xpnpep3 A G 15: 81,436,769 Y283C probably benign Het
Zscan18 A G 7: 12,770,864 S609P probably benign Het
Other mutations in Pik3r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Pik3r4 APN 9 105644604 missense possibly damaging 0.75
IGL01617:Pik3r4 APN 9 105654965 missense probably benign 0.33
IGL01764:Pik3r4 APN 9 105685122 splice site probably benign
IGL01817:Pik3r4 APN 9 105650822 missense probably damaging 1.00
IGL01830:Pik3r4 APN 9 105644955 missense probably damaging 1.00
IGL01905:Pik3r4 APN 9 105644878 nonsense probably null
IGL01947:Pik3r4 APN 9 105686150 missense possibly damaging 0.91
IGL01985:Pik3r4 APN 9 105663045 missense probably benign 0.03
IGL02321:Pik3r4 APN 9 105644478 missense probably benign 0.04
IGL02389:Pik3r4 APN 9 105650331 missense possibly damaging 0.88
IGL02898:Pik3r4 APN 9 105650406 missense probably benign 0.21
IGL03037:Pik3r4 APN 9 105650813 missense probably damaging 1.00
boteh UTSW 9 105667938 splice site probably null
truth UTSW 9 105650606 missense probably damaging 0.98
verisimilitude UTSW 9 105678153 missense probably benign 0.17
IGL02835:Pik3r4 UTSW 9 105672706 missense probably benign 0.07
R0011:Pik3r4 UTSW 9 105644637 missense probably benign 0.01
R0312:Pik3r4 UTSW 9 105686210 missense probably damaging 1.00
R0321:Pik3r4 UTSW 9 105648707 missense probably damaging 1.00
R0482:Pik3r4 UTSW 9 105669045 missense probably benign 0.04
R0645:Pik3r4 UTSW 9 105669187 splice site probably benign
R0690:Pik3r4 UTSW 9 105653976 missense possibly damaging 0.81
R0789:Pik3r4 UTSW 9 105685167 missense probably benign 0.14
R0894:Pik3r4 UTSW 9 105667771 missense possibly damaging 0.73
R0988:Pik3r4 UTSW 9 105687205 missense probably damaging 0.97
R1123:Pik3r4 UTSW 9 105663129 missense probably benign
R1172:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1174:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1342:Pik3r4 UTSW 9 105650901 critical splice donor site probably null
R1387:Pik3r4 UTSW 9 105644291 missense probably damaging 1.00
R1480:Pik3r4 UTSW 9 105687244 missense probably benign 0.39
R1638:Pik3r4 UTSW 9 105687209 missense probably damaging 1.00
R1643:Pik3r4 UTSW 9 105687152 missense possibly damaging 0.83
R1995:Pik3r4 UTSW 9 105669165 missense probably benign 0.12
R2037:Pik3r4 UTSW 9 105650335 missense probably benign 0.00
R2165:Pik3r4 UTSW 9 105672785 missense probably benign 0.05
R4210:Pik3r4 UTSW 9 105650758 missense possibly damaging 0.57
R4515:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4519:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4630:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4632:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4732:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4733:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4940:Pik3r4 UTSW 9 105668994 missense probably benign 0.20
R5120:Pik3r4 UTSW 9 105669009 missense probably benign 0.30
R5169:Pik3r4 UTSW 9 105678161 missense probably benign 0.14
R5183:Pik3r4 UTSW 9 105682308 missense possibly damaging 0.87
R5353:Pik3r4 UTSW 9 105667938 splice site probably null
R5463:Pik3r4 UTSW 9 105648731 missense probably damaging 1.00
R5763:Pik3r4 UTSW 9 105669775 missense probably benign 0.01
R5830:Pik3r4 UTSW 9 105644824 nonsense probably null
R6251:Pik3r4 UTSW 9 105654048 missense probably benign
R6468:Pik3r4 UTSW 9 105685190 missense possibly damaging 0.86
R6611:Pik3r4 UTSW 9 105644277 missense probably damaging 0.99
R6642:Pik3r4 UTSW 9 105644646 missense probably benign 0.11
R6821:Pik3r4 UTSW 9 105650606 missense probably damaging 0.98
R7039:Pik3r4 UTSW 9 105676890 missense possibly damaging 0.76
R7144:Pik3r4 UTSW 9 105650584 missense probably damaging 0.98
R7410:Pik3r4 UTSW 9 105650591 missense probably damaging 0.99
R7559:Pik3r4 UTSW 9 105678153 missense probably benign 0.17
R7561:Pik3r4 UTSW 9 105687247 missense possibly damaging 0.94
R7658:Pik3r4 UTSW 9 105644511 missense probably damaging 0.98
R7727:Pik3r4 UTSW 9 105669882 missense probably damaging 0.99
R7871:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
R7957:Pik3r4 UTSW 9 105687209 missense probably damaging 1.00
R8138:Pik3r4 UTSW 9 105669035 missense possibly damaging 0.55
R8686:Pik3r4 UTSW 9 105658529 missense possibly damaging 0.50
R8719:Pik3r4 UTSW 9 105682195 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAACCTTCATCTGTTAGTCAGCC -3'
(R):5'- GGAGTCACTGCATTTCCGTG -3'

Sequencing Primer
(F):5'- TGTTAGTCAGCCTGCGAC -3'
(R):5'- GGAAGTGGGAAGGGTATTTACTAC -3'
Posted On2016-12-15