Incidental Mutation 'R5635:Sec14l3'
ID448668
Institutional Source Beutler Lab
Gene Symbol Sec14l3
Ensembl Gene ENSMUSG00000054986
Gene NameSEC14-like lipid binding 3
Synonyms
MMRRC Submission 043286-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5635 (G1)
Quality Score167
Status Validated
Chromosome11
Chromosomal Location4064841-4077736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4071484 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 219 (V219E)
Ref Sequence ENSEMBL: ENSMUSP00000065084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068322]
Predicted Effect probably damaging
Transcript: ENSMUST00000068322
AA Change: V219E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065084
Gene: ENSMUSG00000054986
AA Change: V219E

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 2.71e-7 SMART
SEC14 76 247 1.18e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129330
Meta Mutation Damage Score 0.4475 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein encoded by the Saccharomyces cerevisiae SEC14 gene. The SEC14 protein is a phophatidylinositol transfer protein that is essential for biogenesis of Golgi-derived transport vesicles, and thus is required for the export of yeast secretory proteins from the Golgi complex. The specific function of this protein has not yet been determined. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,218,277 M53K possibly damaging Het
Aldh3b3 C T 19: 3,968,512 T409I probably benign Het
Ankrd13a C A 5: 114,801,717 H468Q possibly damaging Het
Ap2a1 A C 7: 44,923,901 probably benign Het
Arfgef1 A T 1: 10,188,860 S671T possibly damaging Het
C1ra G A 6: 124,516,724 C145Y probably damaging Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ccdc30 T C 4: 119,359,674 N123D possibly damaging Het
Cdc20 A T 4: 118,436,027 V232E possibly damaging Het
Cfap58 T A 19: 47,983,542 V637E possibly damaging Het
Coq4 T A 2: 29,788,355 V24E possibly damaging Het
Crim1 T A 17: 78,315,641 F423I probably damaging Het
Crls1 T C 2: 132,864,142 V262A possibly damaging Het
Crybb1 T C 5: 112,257,559 probably null Het
Cutc T A 19: 43,755,630 N23K probably benign Het
Cxcl10 T A 5: 92,347,839 I82F probably damaging Het
Cyp3a44 A T 5: 145,801,314 F60L possibly damaging Het
Dhx9 A G 1: 153,483,747 M35T probably benign Het
Dnah8 A G 17: 30,706,386 E1265G probably benign Het
Dzank1 C G 2: 144,483,407 D548H probably damaging Het
Eef2kmt A G 16: 5,249,029 V120A probably damaging Het
Elp4 A G 2: 105,814,264 probably null Het
Etl4 A T 2: 20,807,035 I1310F probably damaging Het
Exoc6b A T 6: 84,851,927 F492I probably damaging Het
F2rl2 A T 13: 95,700,782 I112F possibly damaging Het
Farp1 T A 14: 121,276,304 I837N possibly damaging Het
Fars2 A G 13: 36,410,146 E378G probably damaging Het
Fgg A G 3: 83,011,423 T248A probably benign Het
Flrt3 T A 2: 140,660,500 T403S probably damaging Het
Fndc3b C T 3: 27,541,931 E170K probably damaging Het
Gm17728 A G 17: 9,422,370 H104R probably benign Het
Hist2h2ab C A 3: 96,220,277 T121K possibly damaging Het
Hivep1 A G 13: 42,160,127 T1948A probably benign Het
Hspa4l T A 3: 40,745,745 I23N probably damaging Het
Ighv1-75 A G 12: 115,834,209 V31A probably benign Het
Kalrn T A 16: 34,014,084 N627I probably damaging Het
Lrp1b T G 2: 42,652,822 probably benign Het
Lrrc36 G A 8: 105,457,573 V480M probably damaging Het
Map4k3 A T 17: 80,613,495 N534K possibly damaging Het
Mybpc3 C T 2: 91,134,829 T1081I probably benign Het
Nfrkb T C 9: 31,399,298 S351P probably damaging Het
Nme4 A T 17: 26,094,231 V43E probably damaging Het
Notch1 C T 2: 26,476,161 E794K probably damaging Het
Nufip1 A T 14: 76,126,146 K270M probably damaging Het
Olfr1093 A G 2: 86,785,726 probably null Het
Olfr1330 G T 4: 118,893,635 G184V probably benign Het
Olfr390 G T 11: 73,787,634 R232L probably benign Het
Olfr65 G A 7: 103,906,638 M66I probably benign Het
Olfr919 A G 9: 38,698,159 I73T possibly damaging Het
Pcdhb15 T A 18: 37,473,770 Y18* probably null Het
Pcdhb21 A T 18: 37,513,917 Y33F probably benign Het
Pds5b T A 5: 150,778,221 H772Q possibly damaging Het
Pik3r4 C A 9: 105,667,825 H168N probably benign Het
Pitpnm3 A G 11: 72,067,160 S386P possibly damaging Het
Plg A G 17: 12,395,754 H307R probably damaging Het
Prdm9 A C 17: 15,562,440 D96E probably damaging Het
Prmt8 A G 6: 127,768,729 S7P probably damaging Het
Prune2 T C 19: 17,118,209 V359A probably benign Het
Pxn A T 5: 115,551,492 Q279L probably benign Het
Rarb A T 14: 16,443,788 C167S probably damaging Het
Rps6kb2 T A 19: 4,161,134 I131F probably damaging Het
Simc1 A G 13: 54,525,404 T522A probably benign Het
Slc1a6 T C 10: 78,789,091 V110A possibly damaging Het
Slc38a11 T G 2: 65,361,403 probably null Het
Snx13 T A 12: 35,140,171 D840E probably benign Het
Sp100 C A 1: 85,682,264 probably benign Het
Spc24 G T 9: 21,757,390 L104I probably damaging Het
Surf4 T C 2: 26,933,313 N4D probably benign Het
Tas2r131 A T 6: 132,957,608 D79E probably benign Het
Tbc1d20 T C 2: 152,311,461 S304P probably benign Het
Tbrg1 T C 9: 37,654,991 probably benign Het
Tmem214 A G 5: 30,871,517 N150S probably damaging Het
Trappc13 A T 13: 104,150,098 I217K probably benign Het
Ttc41 T A 10: 86,736,977 C738S probably benign Het
Ttn T C 2: 76,709,724 Q25979R probably benign Het
Tubb2b A T 13: 34,128,197 N204K probably damaging Het
Ube3a T A 7: 59,288,488 M713K probably damaging Het
Usp37 T C 1: 74,495,811 probably benign Het
Vegfb T A 19: 6,982,846 *189C probably null Het
Vmn2r82 A G 10: 79,378,818 N212D probably benign Het
Vta1 A T 10: 14,668,122 probably null Het
Wdr66 A T 5: 123,322,572 Q225L probably benign Het
Xdh T G 17: 73,913,875 I620L possibly damaging Het
Xpnpep3 A G 15: 81,436,769 Y283C probably benign Het
Zscan18 A G 7: 12,770,864 S609P probably benign Het
Other mutations in Sec14l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Sec14l3 APN 11 4076238 splice site probably benign
IGL01382:Sec14l3 APN 11 4068104 missense probably damaging 0.98
IGL02304:Sec14l3 APN 11 4074768 missense probably damaging 1.00
IGL02565:Sec14l3 APN 11 4076237 splice site probably benign
IGL02836:Sec14l3 APN 11 4070084 missense probably benign 0.02
R0183:Sec14l3 UTSW 11 4075547 missense probably benign 0.03
R0597:Sec14l3 UTSW 11 4074814 missense probably damaging 1.00
R1425:Sec14l3 UTSW 11 4066487 missense probably damaging 1.00
R1834:Sec14l3 UTSW 11 4066510 splice site probably benign
R2090:Sec14l3 UTSW 11 4075481 missense probably benign 0.00
R3839:Sec14l3 UTSW 11 4071544 intron probably null
R4424:Sec14l3 UTSW 11 4066210 missense probably damaging 1.00
R4948:Sec14l3 UTSW 11 4068101 missense possibly damaging 0.75
R5124:Sec14l3 UTSW 11 4075209 missense possibly damaging 0.67
R5588:Sec14l3 UTSW 11 4066138 missense probably damaging 1.00
R6185:Sec14l3 UTSW 11 4075244 missense probably damaging 1.00
R6192:Sec14l3 UTSW 11 4075566 splice site probably null
R6699:Sec14l3 UTSW 11 4075193 missense possibly damaging 0.78
R7002:Sec14l3 UTSW 11 4075263 missense possibly damaging 0.87
R7351:Sec14l3 UTSW 11 4074785 missense probably benign 0.00
R7357:Sec14l3 UTSW 11 4070127 missense probably benign 0.03
R7845:Sec14l3 UTSW 11 4067972 missense probably benign 0.38
R7890:Sec14l3 UTSW 11 4074795 missense probably damaging 0.96
R8108:Sec14l3 UTSW 11 4066198 missense probably damaging 1.00
RF011:Sec14l3 UTSW 11 4067963 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGATGACGGGCTCACTTGTG -3'
(R):5'- CAGCTTAGGTGTGAAGCATGGG -3'

Sequencing Primer
(F):5'- ACTGATAGATGGCTAGTTAGTTGGC -3'
(R):5'- GGATGGACCAGCCTTACTCTACAG -3'
Posted On2016-12-15