Incidental Mutation 'R5635:Pitpnm3'
ID448669
Institutional Source Beutler Lab
Gene Symbol Pitpnm3
Ensembl Gene ENSMUSG00000040543
Gene NamePITPNM family member 3
SynonymsAckr6, A330068P14Rik
MMRRC Submission 043286-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5635 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72047528-72135778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72067160 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 386 (S386P)
Ref Sequence ENSEMBL: ENSMUSP00000104148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075258] [ENSMUST00000108508]
AlphaFold Q3UHE1
Predicted Effect possibly damaging
Transcript: ENSMUST00000075258
AA Change: S402P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074737
Gene: ENSMUSG00000040543
AA Change: S402P

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Blast:DDHD 141 361 1e-105 BLAST
DDHD 390 594 1.49e-91 SMART
LNS2 739 870 2.12e-55 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108508
AA Change: S386P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104148
Gene: ENSMUSG00000040543
AA Change: S386P

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
Blast:DDHD 125 345 1e-106 BLAST
DDHD 374 578 1.49e-91 SMART
LNS2 723 854 2.12e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142471
Meta Mutation Damage Score 0.5905 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,218,277 M53K possibly damaging Het
Aldh3b3 C T 19: 3,968,512 T409I probably benign Het
Ankrd13a C A 5: 114,801,717 H468Q possibly damaging Het
Ap2a1 A C 7: 44,923,901 probably benign Het
Arfgef1 A T 1: 10,188,860 S671T possibly damaging Het
C1ra G A 6: 124,516,724 C145Y probably damaging Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ccdc30 T C 4: 119,359,674 N123D possibly damaging Het
Cdc20 A T 4: 118,436,027 V232E possibly damaging Het
Cfap58 T A 19: 47,983,542 V637E possibly damaging Het
Coq4 T A 2: 29,788,355 V24E possibly damaging Het
Crim1 T A 17: 78,315,641 F423I probably damaging Het
Crls1 T C 2: 132,864,142 V262A possibly damaging Het
Crybb1 T C 5: 112,257,559 probably null Het
Cutc T A 19: 43,755,630 N23K probably benign Het
Cxcl10 T A 5: 92,347,839 I82F probably damaging Het
Cyp3a44 A T 5: 145,801,314 F60L possibly damaging Het
Dhx9 A G 1: 153,483,747 M35T probably benign Het
Dnah8 A G 17: 30,706,386 E1265G probably benign Het
Dzank1 C G 2: 144,483,407 D548H probably damaging Het
Eef2kmt A G 16: 5,249,029 V120A probably damaging Het
Elp4 A G 2: 105,814,264 probably null Het
Etl4 A T 2: 20,807,035 I1310F probably damaging Het
Exoc6b A T 6: 84,851,927 F492I probably damaging Het
F2rl2 A T 13: 95,700,782 I112F possibly damaging Het
Farp1 T A 14: 121,276,304 I837N possibly damaging Het
Fars2 A G 13: 36,410,146 E378G probably damaging Het
Fgg A G 3: 83,011,423 T248A probably benign Het
Flrt3 T A 2: 140,660,500 T403S probably damaging Het
Fndc3b C T 3: 27,541,931 E170K probably damaging Het
Gm17728 A G 17: 9,422,370 H104R probably benign Het
Hist2h2ab C A 3: 96,220,277 T121K possibly damaging Het
Hivep1 A G 13: 42,160,127 T1948A probably benign Het
Hspa4l T A 3: 40,745,745 I23N probably damaging Het
Ighv1-75 A G 12: 115,834,209 V31A probably benign Het
Kalrn T A 16: 34,014,084 N627I probably damaging Het
Lrp1b T G 2: 42,652,822 probably benign Het
Lrrc36 G A 8: 105,457,573 V480M probably damaging Het
Map4k3 A T 17: 80,613,495 N534K possibly damaging Het
Mybpc3 C T 2: 91,134,829 T1081I probably benign Het
Nfrkb T C 9: 31,399,298 S351P probably damaging Het
Nme4 A T 17: 26,094,231 V43E probably damaging Het
Notch1 C T 2: 26,476,161 E794K probably damaging Het
Nufip1 A T 14: 76,126,146 K270M probably damaging Het
Olfr1093 A G 2: 86,785,726 probably null Het
Olfr1330 G T 4: 118,893,635 G184V probably benign Het
Olfr390 G T 11: 73,787,634 R232L probably benign Het
Olfr65 G A 7: 103,906,638 M66I probably benign Het
Olfr919 A G 9: 38,698,159 I73T possibly damaging Het
Pcdhb15 T A 18: 37,473,770 Y18* probably null Het
Pcdhb21 A T 18: 37,513,917 Y33F probably benign Het
Pds5b T A 5: 150,778,221 H772Q possibly damaging Het
Pik3r4 C A 9: 105,667,825 H168N probably benign Het
Plg A G 17: 12,395,754 H307R probably damaging Het
Prdm9 A C 17: 15,562,440 D96E probably damaging Het
Prmt8 A G 6: 127,768,729 S7P probably damaging Het
Prune2 T C 19: 17,118,209 V359A probably benign Het
Pxn A T 5: 115,551,492 Q279L probably benign Het
Rarb A T 14: 16,443,788 C167S probably damaging Het
Rps6kb2 T A 19: 4,161,134 I131F probably damaging Het
Sec14l3 T A 11: 4,071,484 V219E probably damaging Het
Simc1 A G 13: 54,525,404 T522A probably benign Het
Slc1a6 T C 10: 78,789,091 V110A possibly damaging Het
Slc38a11 T G 2: 65,361,403 probably null Het
Snx13 T A 12: 35,140,171 D840E probably benign Het
Sp100 C A 1: 85,682,264 probably benign Het
Spc24 G T 9: 21,757,390 L104I probably damaging Het
Surf4 T C 2: 26,933,313 N4D probably benign Het
Tas2r131 A T 6: 132,957,608 D79E probably benign Het
Tbc1d20 T C 2: 152,311,461 S304P probably benign Het
Tbrg1 T C 9: 37,654,991 probably benign Het
Tmem214 A G 5: 30,871,517 N150S probably damaging Het
Trappc13 A T 13: 104,150,098 I217K probably benign Het
Ttc41 T A 10: 86,736,977 C738S probably benign Het
Ttn T C 2: 76,709,724 Q25979R probably benign Het
Tubb2b A T 13: 34,128,197 N204K probably damaging Het
Ube3a T A 7: 59,288,488 M713K probably damaging Het
Usp37 T C 1: 74,495,811 probably benign Het
Vegfb T A 19: 6,982,846 *189C probably null Het
Vmn2r82 A G 10: 79,378,818 N212D probably benign Het
Vta1 A T 10: 14,668,122 probably null Het
Wdr66 A T 5: 123,322,572 Q225L probably benign Het
Xdh T G 17: 73,913,875 I620L possibly damaging Het
Xpnpep3 A G 15: 81,436,769 Y283C probably benign Het
Zscan18 A G 7: 12,770,864 S609P probably benign Het
Other mutations in Pitpnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Pitpnm3 APN 11 72112251 splice site probably benign
IGL01871:Pitpnm3 APN 11 72056138 missense probably damaging 0.99
IGL02058:Pitpnm3 APN 11 72120139 missense probably benign 0.31
IGL02267:Pitpnm3 APN 11 72071448 missense probably benign 0.02
IGL02370:Pitpnm3 APN 11 72051858 missense probably benign 0.04
IGL02613:Pitpnm3 APN 11 72058072 missense probably damaging 1.00
IGL02835:Pitpnm3 APN 11 72061466 splice site probably benign
IGL02946:Pitpnm3 APN 11 72092552 missense probably benign 0.08
IGL02989:Pitpnm3 APN 11 72120186 splice site probably benign
IGL03173:Pitpnm3 APN 11 72092563 missense probably benign 0.02
IGL03357:Pitpnm3 APN 11 72070890 nonsense probably null
Frank UTSW 11 72070396 missense probably benign
Mickey UTSW 11 72070964 missense probably damaging 1.00
Stuart UTSW 11 72051929 missense probably null 0.99
R0102:Pitpnm3 UTSW 11 72056246 missense probably damaging 1.00
R0193:Pitpnm3 UTSW 11 72070492 splice site probably benign
R0964:Pitpnm3 UTSW 11 72058470 missense probably damaging 1.00
R1475:Pitpnm3 UTSW 11 72074627 missense probably damaging 1.00
R1566:Pitpnm3 UTSW 11 72058959 splice site probably null
R1951:Pitpnm3 UTSW 11 72074624 missense possibly damaging 0.88
R3915:Pitpnm3 UTSW 11 72112284 missense probably damaging 1.00
R4192:Pitpnm3 UTSW 11 72051959 missense possibly damaging 0.96
R4278:Pitpnm3 UTSW 11 72074516 missense probably damaging 1.00
R4928:Pitpnm3 UTSW 11 72063172 missense probably damaging 1.00
R5543:Pitpnm3 UTSW 11 72056197 missense probably damaging 0.99
R5626:Pitpnm3 UTSW 11 72112332 missense probably benign 0.04
R5958:Pitpnm3 UTSW 11 72112367 splice site probably null
R6531:Pitpnm3 UTSW 11 72071487 missense possibly damaging 0.94
R6634:Pitpnm3 UTSW 11 72051929 missense probably null 0.99
R6764:Pitpnm3 UTSW 11 72051233 missense probably damaging 1.00
R6912:Pitpnm3 UTSW 11 72070396 missense probably benign
R7132:Pitpnm3 UTSW 11 72051276 missense possibly damaging 0.86
R7307:Pitpnm3 UTSW 11 72070964 missense probably damaging 1.00
R7561:Pitpnm3 UTSW 11 72051182 missense probably benign 0.02
R7771:Pitpnm3 UTSW 11 72061488 nonsense probably null
R8099:Pitpnm3 UTSW 11 72070318 missense possibly damaging 0.85
R8753:Pitpnm3 UTSW 11 72051878 missense probably benign 0.01
R8817:Pitpnm3 UTSW 11 72051068 missense possibly damaging 0.74
R8987:Pitpnm3 UTSW 11 72112306 missense probably damaging 1.00
R9054:Pitpnm3 UTSW 11 72056191 missense probably damaging 0.97
X0018:Pitpnm3 UTSW 11 72071440 missense probably benign 0.42
X0062:Pitpnm3 UTSW 11 72067108 missense probably damaging 1.00
Z1186:Pitpnm3 UTSW 11 72064129 missense probably benign
Z1186:Pitpnm3 UTSW 11 72120143 missense probably benign
Z1187:Pitpnm3 UTSW 11 72064129 missense probably benign
Z1187:Pitpnm3 UTSW 11 72120143 missense probably benign
Z1188:Pitpnm3 UTSW 11 72064129 missense probably benign
Z1188:Pitpnm3 UTSW 11 72120143 missense probably benign
Z1189:Pitpnm3 UTSW 11 72064129 missense probably benign
Z1189:Pitpnm3 UTSW 11 72120143 missense probably benign
Z1190:Pitpnm3 UTSW 11 72064129 missense probably benign
Z1190:Pitpnm3 UTSW 11 72120143 missense probably benign
Z1191:Pitpnm3 UTSW 11 72064129 missense probably benign
Z1191:Pitpnm3 UTSW 11 72120143 missense probably benign
Z1192:Pitpnm3 UTSW 11 72064129 missense probably benign
Z1192:Pitpnm3 UTSW 11 72120143 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAAGCCACCTATCTTCTC -3'
(R):5'- ACTAAGTCACGAGCCTCTGTG -3'

Sequencing Primer
(F):5'- AGCCACCTATCTTCTCCCCCAG -3'
(R):5'- GATGGTGTCAAAAAGTGCTCTC -3'
Posted On2016-12-15