Mutagenetix > Incidental Mutation

Incidental Mutation 'R0546:Dhfr'

44867

Institutional Source

Beutler Lab

Gene Symbol

Dhfr

Ensembl Gene

ENSMUSG00000021707

Gene Name

dihydrofolate reductase

Synonyms

8430436I03Rik

MMRRC Submission

038738-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0546 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92491291-92525561 bp(+) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

G to A at 92504692 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022218 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022218] [ENSMUST00000022218] [ENSMUST00000022218]

AlphaFold

P00375

PDB Structure

Understanding the Role of Leu22 Variants in Methotrexate Resistance: Comparison of Wild-type and Leu22Arg Variant Mouse and Human Dihydrofolate Reductase [X-RAY DIFFRACTION]
New Insights into DHFR Interactions: Analysis of Pneumocystis carinii and Mouse DHFR Complexes with NADPH and Two Highly Potent Trimethoprim Derivatives [X-RAY DIFFRACTION]
Structural Analysis of a Holo Enzyme Complex of Mouse Dihydrofolate Reductase with NADPH and a Ternary Complex wtih the Potent and Selective Inhibitor 2,4-Diamino-6-(2'-hydroxydibenz[b,f]azepin-5-yl)methylpteridine [X-RAY DIFFRACTION]
Structural Analysis of a Holo Enzyme Complex of Mouse Dihydrofolate Reductase with NADPH and a Ternary Complex with the Potent and Selective Inhibitor 2.4-Diamino-6-(-2'-hydroxydibenz[b,f]azepin-5-yl)methylpteridine [X-RAY DIFFRACTION]
Alternate Binding Modes Observed for the E- and Z-isomers of 2,4-Diaminofuro[2,3d]pyrimidines as Ternary Complexes with NADPH and Mouse Dihydrofolate Reductase [X-RAY DIFFRACTION]
Alternate Binding Modes Observed for the E- and Z-Isomers of 2,4-Diaminofuro[2,3-d]pyrimidines as Ternary Complexes with NADPH and Mouse Dihydrofolate Reductase [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000022218

SMART Domains

Protein: ENSMUSP00000022218
Gene: ENSMUSG00000021707

Domain	Start	End	E-Value	Type
Pfam:DHFR_1	4	185	3.9e-37	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000022218

SMART Domains

Protein: ENSMUSP00000022218
Gene: ENSMUSG00000021707

Domain	Start	End	E-Value	Type
Pfam:DHFR_1	4	185	3.9e-37	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000022218

SMART Domains

Protein: ENSMUSP00000022218
Gene: ENSMUSG00000021707

Domain	Start	End	E-Value	Type
Pfam:DHFR_1	4	185	3.9e-37	PFAM

Meta Mutation Damage Score

0.9495

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.0%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality soon after E14.5 with reduced size, pallor, impaired hematopoiesis and abnormal folic acid levels. Mice heterozygous for this allele exhibit abnormal folic acid levels, abnormal hemopoiesis and reduced endothelium-dependent vasorelaxation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	A	G	6: 23,077,076 (GRCm39)		probably null	Het
Actn1	C	T	12: 80,225,208 (GRCm39)	R418Q	probably benign	Het
Adam39	G	A	8: 41,279,468 (GRCm39)	V620M	probably damaging	Het
Agr3	C	A	12: 35,978,329 (GRCm39)	T14K	probably benign	Het
Alpk2	T	C	18: 65,439,788 (GRCm39)	D1002G	probably benign	Het
Amz2	T	A	11: 109,324,780 (GRCm39)	N221K	probably benign	Het
Aox4	A	G	1: 58,289,333 (GRCm39)	E752G	probably damaging	Het
Ap2a1	C	T	7: 44,554,132 (GRCm39)	G500S	probably damaging	Het
Car5b	G	A	X: 162,762,297 (GRCm39)	R282C	probably damaging	Het
Ccdc112	A	G	18: 46,424,139 (GRCm39)	S200P	possibly damaging	Het
Ccdc18	A	T	5: 108,322,830 (GRCm39)	E643D	probably benign	Het
Ccdc180	A	T	4: 45,904,597 (GRCm39)	T398S	possibly damaging	Het
Cnp	A	G	11: 100,471,549 (GRCm39)	Y397C	probably damaging	Het
Cpa4	T	C	6: 30,580,962 (GRCm39)	W184R	probably damaging	Het
Crebbp	A	T	16: 3,903,671 (GRCm39)	I1856N	probably damaging	Het
Ctrl	A	G	8: 106,658,966 (GRCm39)	I200T	probably damaging	Het
Cyfip1	C	T	7: 55,572,564 (GRCm39)	R934*	probably null	Het
Dennd5a	A	G	7: 109,520,633 (GRCm39)	V408A	probably benign	Het
Dnajc6	A	T	4: 101,492,388 (GRCm39)	N740Y	probably damaging	Het
Fam110a	T	C	2: 151,812,732 (GRCm39)	T13A	probably benign	Het
Fars2	G	T	13: 36,388,569 (GRCm39)	K19N	probably benign	Het
Fer1l6	A	T	15: 58,430,257 (GRCm39)		probably null	Het
Gabra1	T	A	11: 42,053,428 (GRCm39)	T69S	probably damaging	Het
Galnt18	T	G	7: 111,107,348 (GRCm39)	N475T	probably damaging	Het
Gbp4	T	C	5: 105,268,836 (GRCm39)	Y439C	probably damaging	Het
Gpatch2l	A	G	12: 86,335,622 (GRCm39)	*409W	probably null	Het
Hip1r	T	C	5: 124,137,114 (GRCm39)	V658A	possibly damaging	Het
Hspg2	A	G	4: 137,229,605 (GRCm39)	D73G	probably benign	Het
Ifitm2	A	G	7: 140,535,656 (GRCm39)	V58A	possibly damaging	Het
Ift172	T	C	5: 31,414,945 (GRCm39)	D1359G	probably benign	Het
Ing1	A	G	8: 11,607,031 (GRCm39)	D41G	probably damaging	Het
Itgal	C	T	7: 126,909,486 (GRCm39)	T446I	probably benign	Het
Itgav	G	T	2: 83,633,586 (GRCm39)	M978I	probably benign	Het
Jazf1	A	G	6: 52,754,681 (GRCm39)	Y132H	possibly damaging	Het
Lgr4	T	A	2: 109,829,766 (GRCm39)	N211K	probably damaging	Het
Mgat4d	A	G	8: 84,082,350 (GRCm39)	N100S	possibly damaging	Het
Mrgprb3	T	C	7: 48,293,263 (GRCm39)	Y96C	probably damaging	Het
Myh11	A	C	16: 14,023,492 (GRCm39)	L1562R	probably damaging	Het
Mylk	G	C	16: 34,699,845 (GRCm39)	E403Q	possibly damaging	Het
Myo15a	A	G	11: 60,397,139 (GRCm39)	Y2667C	probably damaging	Het
Or14j7	T	A	17: 38,235,229 (GRCm39)	C257*	probably null	Het
Or52ae7	A	G	7: 103,119,907 (GRCm39)	I220M	possibly damaging	Het
Or6c70	G	A	10: 129,710,407 (GRCm39)	T73I	possibly damaging	Het
Or8k37	T	A	2: 86,469,573 (GRCm39)	T160S	possibly damaging	Het
Or8k38	C	T	2: 86,488,235 (GRCm39)	C189Y	possibly damaging	Het
Or9m2	T	A	2: 87,820,816 (GRCm39)	Y120*	probably null	Het
Paox	G	T	7: 139,711,591 (GRCm39)	G148W	probably damaging	Het
Pkd1	T	C	17: 24,799,112 (GRCm39)	V2777A	probably benign	Het
Plod2	T	A	9: 92,477,388 (GRCm39)	V360E	probably damaging	Het
Prune2	T	C	19: 16,998,030 (GRCm39)		probably benign	Het
Sbds	G	T	5: 130,282,919 (GRCm39)	A3D	possibly damaging	Het
Sec23a	T	C	12: 59,031,953 (GRCm39)	T426A	probably benign	Het
Sec31a	T	C	5: 100,551,929 (GRCm39)	Y148C	probably damaging	Het
Shprh	T	A	10: 11,059,631 (GRCm39)		probably benign	Het
Slc16a7	A	G	10: 125,066,742 (GRCm39)	V299A	probably benign	Het
Smg8	T	C	11: 86,974,439 (GRCm39)	Y174C	possibly damaging	Het
Snx22	T	A	9: 65,976,059 (GRCm39)	Y58F	probably damaging	Het
Snx25	A	G	8: 46,556,667 (GRCm39)	Y308H	probably benign	Het
St3gal2	A	G	8: 111,696,738 (GRCm39)		probably null	Het
Stab1	C	T	14: 30,861,507 (GRCm39)	R2500H	possibly damaging	Het
Steap4	T	C	5: 8,025,870 (GRCm39)	S144P	probably damaging	Het
Stfa3	T	A	16: 36,272,619 (GRCm39)		probably benign	Het
Tmprss9	C	A	10: 80,735,157 (GRCm39)	Q1095K	probably benign	Het
Top2a	A	G	11: 98,890,052 (GRCm39)	V1217A	possibly damaging	Het
Trhr2	A	G	8: 123,085,228 (GRCm39)		probably null	Het
Trim7	A	G	11: 48,736,336 (GRCm39)	E23G	probably damaging	Het
Trpv3	A	T	11: 73,188,013 (GRCm39)	E788V	probably damaging	Het
Ttn	A	G	2: 76,575,863 (GRCm39)	I25010T	probably damaging	Het
Ube2ql1	T	C	13: 69,887,419 (GRCm39)	H14R	unknown	Het
Uggt1	C	T	1: 36,235,052 (GRCm39)	R419H	probably benign	Het
Xpo4	A	G	14: 57,850,731 (GRCm39)	V391A	probably benign	Het
Zfhx3	A	G	8: 109,520,819 (GRCm39)	D647G	probably damaging	Het
Zfp354c	A	T	11: 50,706,457 (GRCm39)	M206K	probably benign	Het
Zfp804a	A	G	2: 82,089,264 (GRCm39)	N1031S	possibly damaging	Het
Zfp868	A	G	8: 70,064,882 (GRCm39)	V151A	probably benign	Het

Other mutations in Dhfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01659:Dhfr	APN	13	92,492,178 (GRCm39)	splice site	probably null
R1465:Dhfr	UTSW	13	92,504,815 (GRCm39)	splice site	probably benign
R2026:Dhfr	UTSW	13	92,502,279 (GRCm39)	nonsense	probably null
R4905:Dhfr	UTSW	13	92,502,282 (GRCm39)	missense	probably damaging	1.00
R5109:Dhfr	UTSW	13	92,491,788 (GRCm39)	missense	probably damaging	1.00
R7039:Dhfr	UTSW	13	92,491,791 (GRCm39)	missense	probably benign	0.04
R7869:Dhfr	UTSW	13	92,494,471 (GRCm39)	nonsense	probably null
R8905:Dhfr	UTSW	13	92,494,467 (GRCm39)	missense	probably damaging	1.00
R9509:Dhfr	UTSW	13	92,504,739 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGCCTCCACAAATATCAGTACTCAC -3'
(R):5'- TCTGCTGAGCCTTGTAAATTTTCATCCA -3'

Sequencing Primer
(F):5'- CCACAAATATCAGTACTCACAAAAAC -3'
(R):5'- GCCTTGTAAATTTTCATCCATATGTC -3'

Posted On

2013-06-11