Incidental Mutation 'R5635:Farp1'
ID448681
Institutional Source Beutler Lab
Gene Symbol Farp1
Ensembl Gene ENSMUSG00000025555
Gene NameFERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
SynonymsCdep
MMRRC Submission 043286-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5635 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location121035200-121283744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121276304 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 837 (I837N)
Ref Sequence ENSEMBL: ENSMUSP00000026635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026635]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026635
AA Change: I837N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026635
Gene: ENSMUSG00000025555
AA Change: I837N

DomainStartEndE-ValueType
B41 36 230 3.27e-68 SMART
FERM_C 234 324 3.87e-32 SMART
FA 328 374 6.07e-16 SMART
RhoGEF 546 732 2.07e-47 SMART
PH 763 861 1.05e-16 SMART
PH 936 1034 1.55e-19 SMART
Meta Mutation Damage Score 0.9147 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,218,277 M53K possibly damaging Het
Aldh3b3 C T 19: 3,968,512 T409I probably benign Het
Ankrd13a C A 5: 114,801,717 H468Q possibly damaging Het
Ap2a1 A C 7: 44,923,901 probably benign Het
Arfgef1 A T 1: 10,188,860 S671T possibly damaging Het
C1ra G A 6: 124,516,724 C145Y probably damaging Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ccdc30 T C 4: 119,359,674 N123D possibly damaging Het
Cdc20 A T 4: 118,436,027 V232E possibly damaging Het
Cfap58 T A 19: 47,983,542 V637E possibly damaging Het
Coq4 T A 2: 29,788,355 V24E possibly damaging Het
Crim1 T A 17: 78,315,641 F423I probably damaging Het
Crls1 T C 2: 132,864,142 V262A possibly damaging Het
Crybb1 T C 5: 112,257,559 probably null Het
Cutc T A 19: 43,755,630 N23K probably benign Het
Cxcl10 T A 5: 92,347,839 I82F probably damaging Het
Cyp3a44 A T 5: 145,801,314 F60L possibly damaging Het
Dhx9 A G 1: 153,483,747 M35T probably benign Het
Dnah8 A G 17: 30,706,386 E1265G probably benign Het
Dzank1 C G 2: 144,483,407 D548H probably damaging Het
Eef2kmt A G 16: 5,249,029 V120A probably damaging Het
Elp4 A G 2: 105,814,264 probably null Het
Etl4 A T 2: 20,807,035 I1310F probably damaging Het
Exoc6b A T 6: 84,851,927 F492I probably damaging Het
F2rl2 A T 13: 95,700,782 I112F possibly damaging Het
Fars2 A G 13: 36,410,146 E378G probably damaging Het
Fgg A G 3: 83,011,423 T248A probably benign Het
Flrt3 T A 2: 140,660,500 T403S probably damaging Het
Fndc3b C T 3: 27,541,931 E170K probably damaging Het
Gm17728 A G 17: 9,422,370 H104R probably benign Het
Hist2h2ab C A 3: 96,220,277 T121K possibly damaging Het
Hivep1 A G 13: 42,160,127 T1948A probably benign Het
Hspa4l T A 3: 40,745,745 I23N probably damaging Het
Ighv1-75 A G 12: 115,834,209 V31A probably benign Het
Kalrn T A 16: 34,014,084 N627I probably damaging Het
Lrp1b T G 2: 42,652,822 probably benign Het
Lrrc36 G A 8: 105,457,573 V480M probably damaging Het
Map4k3 A T 17: 80,613,495 N534K possibly damaging Het
Mybpc3 C T 2: 91,134,829 T1081I probably benign Het
Nfrkb T C 9: 31,399,298 S351P probably damaging Het
Nme4 A T 17: 26,094,231 V43E probably damaging Het
Notch1 C T 2: 26,476,161 E794K probably damaging Het
Nufip1 A T 14: 76,126,146 K270M probably damaging Het
Olfr1093 A G 2: 86,785,726 probably null Het
Olfr1330 G T 4: 118,893,635 G184V probably benign Het
Olfr390 G T 11: 73,787,634 R232L probably benign Het
Olfr65 G A 7: 103,906,638 M66I probably benign Het
Olfr919 A G 9: 38,698,159 I73T possibly damaging Het
Pcdhb15 T A 18: 37,473,770 Y18* probably null Het
Pcdhb21 A T 18: 37,513,917 Y33F probably benign Het
Pds5b T A 5: 150,778,221 H772Q possibly damaging Het
Pik3r4 C A 9: 105,667,825 H168N probably benign Het
Pitpnm3 A G 11: 72,067,160 S386P possibly damaging Het
Plg A G 17: 12,395,754 H307R probably damaging Het
Prdm9 A C 17: 15,562,440 D96E probably damaging Het
Prmt8 A G 6: 127,768,729 S7P probably damaging Het
Prune2 T C 19: 17,118,209 V359A probably benign Het
Pxn A T 5: 115,551,492 Q279L probably benign Het
Rarb A T 14: 16,443,788 C167S probably damaging Het
Rps6kb2 T A 19: 4,161,134 I131F probably damaging Het
Sec14l3 T A 11: 4,071,484 V219E probably damaging Het
Simc1 A G 13: 54,525,404 T522A probably benign Het
Slc1a6 T C 10: 78,789,091 V110A possibly damaging Het
Slc38a11 T G 2: 65,361,403 probably null Het
Snx13 T A 12: 35,140,171 D840E probably benign Het
Sp100 C A 1: 85,682,264 probably benign Het
Spc24 G T 9: 21,757,390 L104I probably damaging Het
Surf4 T C 2: 26,933,313 N4D probably benign Het
Tas2r131 A T 6: 132,957,608 D79E probably benign Het
Tbc1d20 T C 2: 152,311,461 S304P probably benign Het
Tbrg1 T C 9: 37,654,991 probably benign Het
Tmem214 A G 5: 30,871,517 N150S probably damaging Het
Trappc13 A T 13: 104,150,098 I217K probably benign Het
Ttc41 T A 10: 86,736,977 C738S probably benign Het
Ttn T C 2: 76,709,724 Q25979R probably benign Het
Tubb2b A T 13: 34,128,197 N204K probably damaging Het
Ube3a T A 7: 59,288,488 M713K probably damaging Het
Usp37 T C 1: 74,495,811 probably benign Het
Vegfb T A 19: 6,982,846 *189C probably null Het
Vmn2r82 A G 10: 79,378,818 N212D probably benign Het
Vta1 A T 10: 14,668,122 probably null Het
Wdr66 A T 5: 123,322,572 Q225L probably benign Het
Xdh T G 17: 73,913,875 I620L possibly damaging Het
Xpnpep3 A G 15: 81,436,769 Y283C probably benign Het
Zscan18 A G 7: 12,770,864 S609P probably benign Het
Other mutations in Farp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Farp1 APN 14 121237149 missense probably damaging 1.00
IGL01017:Farp1 APN 14 121272774 missense possibly damaging 0.64
IGL02309:Farp1 APN 14 121243516 missense probably benign
IGL02376:Farp1 APN 14 121272856 missense probably damaging 0.98
IGL03018:Farp1 APN 14 121102169 missense probably benign
IGL03400:Farp1 APN 14 121207321 missense probably damaging 1.00
R0034:Farp1 UTSW 14 121255429 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0219:Farp1 UTSW 14 121243600 missense possibly damaging 0.88
R0359:Farp1 UTSW 14 121255396 splice site probably benign
R0616:Farp1 UTSW 14 121277022 missense probably damaging 1.00
R0653:Farp1 UTSW 14 121233846 critical splice donor site probably null
R0710:Farp1 UTSW 14 121237143 missense probably damaging 1.00
R1391:Farp1 UTSW 14 121257966 nonsense probably null
R1791:Farp1 UTSW 14 121256745 missense probably damaging 1.00
R1920:Farp1 UTSW 14 121255496 missense probably benign 0.16
R1953:Farp1 UTSW 14 121255482 missense probably benign
R1958:Farp1 UTSW 14 121219375 critical splice acceptor site probably null
R2891:Farp1 UTSW 14 121256736 missense probably damaging 1.00
R3121:Farp1 UTSW 14 121222726 splice site probably benign
R4005:Farp1 UTSW 14 121276397 missense probably damaging 0.99
R4257:Farp1 UTSW 14 121255479 missense probably benign 0.00
R4559:Farp1 UTSW 14 121272801 missense probably damaging 1.00
R4654:Farp1 UTSW 14 121276304 missense possibly damaging 0.50
R4739:Farp1 UTSW 14 121238787 missense probably damaging 1.00
R4831:Farp1 UTSW 14 121277057 missense probably damaging 1.00
R4988:Farp1 UTSW 14 121275607 missense probably damaging 1.00
R5379:Farp1 UTSW 14 121256757 missense possibly damaging 0.88
R5463:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5466:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5467:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5511:Farp1 UTSW 14 121237172 missense probably damaging 0.98
R5520:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5639:Farp1 UTSW 14 121275382 missense probably damaging 1.00
R5954:Farp1 UTSW 14 121222667 missense probably damaging 0.99
R6765:Farp1 UTSW 14 121222654 missense probably benign 0.00
R7469:Farp1 UTSW 14 121275421 missense probably damaging 1.00
R7549:Farp1 UTSW 14 121235177 missense possibly damaging 0.89
R7660:Farp1 UTSW 14 121276922 missense probably benign 0.00
R7752:Farp1 UTSW 14 121257947 missense probably damaging 1.00
R7788:Farp1 UTSW 14 121276253 missense probably benign 0.12
R7911:Farp1 UTSW 14 121242406 missense probably damaging 1.00
R8013:Farp1 UTSW 14 121242401 missense probably damaging 1.00
R8078:Farp1 UTSW 14 121276300 missense probably benign 0.04
R8113:Farp1 UTSW 14 121275596 missense probably benign 0.35
R8116:Farp1 UTSW 14 121233820 missense probably damaging 1.00
R8716:Farp1 UTSW 14 121242443 missense probably benign
RF024:Farp1 UTSW 14 121237148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTCCCGCTCTGAATTCTG -3'
(R):5'- CTACTCCACTTACTGTTGTCAGGG -3'

Sequencing Primer
(F):5'- CTGAATTCTGCCTTTACTGGTG -3'
(R):5'- TGCTGGCAAGGAGCTCG -3'
Posted On2016-12-15