Incidental Mutation 'R5635:Xdh'
ID 448690
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 043286-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R5635 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 74220870 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 620 (I620L)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect possibly damaging
Transcript: ENSMUST00000024866
AA Change: I620L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: I620L

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.3967 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,094,273 (GRCm39) M53K possibly damaging Het
Aldh3b3 C T 19: 4,018,512 (GRCm39) T409I probably benign Het
Ankrd13a C A 5: 114,939,778 (GRCm39) H468Q possibly damaging Het
Ap2a1 A C 7: 44,573,325 (GRCm39) probably benign Het
Arfgef1 A T 1: 10,259,085 (GRCm39) S671T possibly damaging Het
C1ra G A 6: 124,493,683 (GRCm39) C145Y probably damaging Het
Catsperd G A 17: 56,939,335 (GRCm39) V55M possibly damaging Het
Ccdc30 T C 4: 119,216,871 (GRCm39) N123D possibly damaging Het
Cdc20 A T 4: 118,293,224 (GRCm39) V232E possibly damaging Het
Cfap251 A T 5: 123,460,635 (GRCm39) Q225L probably benign Het
Cfap58 T A 19: 47,971,981 (GRCm39) V637E possibly damaging Het
Coq4 T A 2: 29,678,367 (GRCm39) V24E possibly damaging Het
Crim1 T A 17: 78,623,070 (GRCm39) F423I probably damaging Het
Crls1 T C 2: 132,706,062 (GRCm39) V262A possibly damaging Het
Crybb1 T C 5: 112,405,425 (GRCm39) probably null Het
Cutc T A 19: 43,744,069 (GRCm39) N23K probably benign Het
Cxcl10 T A 5: 92,495,698 (GRCm39) I82F probably damaging Het
Cyp3a44 A T 5: 145,738,124 (GRCm39) F60L possibly damaging Het
Dhx9 A G 1: 153,359,493 (GRCm39) M35T probably benign Het
Dnah8 A G 17: 30,925,360 (GRCm39) E1265G probably benign Het
Dzank1 C G 2: 144,325,327 (GRCm39) D548H probably damaging Het
Eef2kmt A G 16: 5,066,893 (GRCm39) V120A probably damaging Het
Elp4 A G 2: 105,644,609 (GRCm39) probably null Het
Etl4 A T 2: 20,811,846 (GRCm39) I1310F probably damaging Het
Exoc6b A T 6: 84,828,909 (GRCm39) F492I probably damaging Het
F2rl2 A T 13: 95,837,290 (GRCm39) I112F possibly damaging Het
Farp1 T A 14: 121,513,716 (GRCm39) I837N possibly damaging Het
Fars2 A G 13: 36,594,129 (GRCm39) E378G probably damaging Het
Fgg A G 3: 82,918,730 (GRCm39) T248A probably benign Het
Flrt3 T A 2: 140,502,420 (GRCm39) T403S probably damaging Het
Fndc3b C T 3: 27,596,080 (GRCm39) E170K probably damaging Het
Gm17728 A G 17: 9,641,202 (GRCm39) H104R probably benign Het
H2ac21 C A 3: 96,127,593 (GRCm39) T121K possibly damaging Het
Hivep1 A G 13: 42,313,603 (GRCm39) T1948A probably benign Het
Hspa4l T A 3: 40,700,177 (GRCm39) I23N probably damaging Het
Ighv1-75 A G 12: 115,797,829 (GRCm39) V31A probably benign Het
Kalrn T A 16: 33,834,454 (GRCm39) N627I probably damaging Het
Lrp1b T G 2: 42,542,834 (GRCm39) probably benign Het
Lrrc36 G A 8: 106,184,205 (GRCm39) V480M probably damaging Het
Map4k3 A T 17: 80,920,924 (GRCm39) N534K possibly damaging Het
Mybpc3 C T 2: 90,965,174 (GRCm39) T1081I probably benign Het
Nfrkb T C 9: 31,310,594 (GRCm39) S351P probably damaging Het
Nme4 A T 17: 26,313,205 (GRCm39) V43E probably damaging Het
Notch1 C T 2: 26,366,173 (GRCm39) E794K probably damaging Het
Nufip1 A T 14: 76,363,586 (GRCm39) K270M probably damaging Het
Or10ak16 G T 4: 118,750,832 (GRCm39) G184V probably benign Het
Or1e30 G T 11: 73,678,460 (GRCm39) R232L probably benign Het
Or51b6 G A 7: 103,555,845 (GRCm39) M66I probably benign Het
Or5t5 A G 2: 86,616,070 (GRCm39) probably null Het
Or8g51 A G 9: 38,609,455 (GRCm39) I73T possibly damaging Het
Pcdhb15 T A 18: 37,606,823 (GRCm39) Y18* probably null Het
Pcdhb21 A T 18: 37,646,970 (GRCm39) Y33F probably benign Het
Pds5b T A 5: 150,701,686 (GRCm39) H772Q possibly damaging Het
Pik3r4 C A 9: 105,545,024 (GRCm39) H168N probably benign Het
Pitpnm3 A G 11: 71,957,986 (GRCm39) S386P possibly damaging Het
Plg A G 17: 12,614,641 (GRCm39) H307R probably damaging Het
Prdm9 A C 17: 15,782,702 (GRCm39) D96E probably damaging Het
Prmt8 A G 6: 127,745,692 (GRCm39) S7P probably damaging Het
Prune2 T C 19: 17,095,573 (GRCm39) V359A probably benign Het
Pxn A T 5: 115,689,551 (GRCm39) Q279L probably benign Het
Rarb A T 14: 16,443,788 (GRCm38) C167S probably damaging Het
Rps6kb2 T A 19: 4,211,133 (GRCm39) I131F probably damaging Het
Sec14l3 T A 11: 4,021,484 (GRCm39) V219E probably damaging Het
Simc1 A G 13: 54,673,217 (GRCm39) T522A probably benign Het
Slc1a6 T C 10: 78,624,925 (GRCm39) V110A possibly damaging Het
Slc38a11 T G 2: 65,191,747 (GRCm39) probably null Het
Snx13 T A 12: 35,190,170 (GRCm39) D840E probably benign Het
Sp100 C A 1: 85,609,985 (GRCm39) probably benign Het
Spc24 G T 9: 21,668,686 (GRCm39) L104I probably damaging Het
Surf4 T C 2: 26,823,325 (GRCm39) N4D probably benign Het
Tas2r131 A T 6: 132,934,571 (GRCm39) D79E probably benign Het
Tbc1d20 T C 2: 152,153,381 (GRCm39) S304P probably benign Het
Tbrg1 T C 9: 37,566,287 (GRCm39) probably benign Het
Tmem214 A G 5: 31,028,861 (GRCm39) N150S probably damaging Het
Trappc13 A T 13: 104,286,606 (GRCm39) I217K probably benign Het
Ttc41 T A 10: 86,572,841 (GRCm39) C738S probably benign Het
Ttn T C 2: 76,540,068 (GRCm39) Q25979R probably benign Het
Tubb2b A T 13: 34,312,180 (GRCm39) N204K probably damaging Het
Ube3a T A 7: 58,938,236 (GRCm39) M713K probably damaging Het
Usp37 T C 1: 74,534,970 (GRCm39) probably benign Het
Vegfb T A 19: 6,960,214 (GRCm39) *189C probably null Het
Vmn2r82 A G 10: 79,214,652 (GRCm39) N212D probably benign Het
Vta1 A T 10: 14,543,866 (GRCm39) probably null Het
Xpnpep3 A G 15: 81,320,970 (GRCm39) Y283C probably benign Het
Zscan18 A G 7: 12,504,791 (GRCm39) S609P probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAACCTCAGGTACCGTG -3'
(R):5'- GGCCTATAGAGAAACCGTGTC -3'

Sequencing Primer
(F):5'- AGGTACCGTGCCTGAACTC -3'
(R):5'- GCCAGACTGGTACCCATATTG -3'
Posted On 2016-12-15