Mutagenetix > Incidental Mutation

Incidental Mutation 'R5635:Crim1'

448691

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

MMRRC Submission

043286-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5635 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78315641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 423 (F423I)

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

AlphaFold

Q9JLL0

Predicted Effect

probably damaging
Transcript: ENSMUST00000112498
AA Change: F423I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: F423I

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Meta Mutation Damage Score

0.1290

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	T	A	10: 29,218,277	M53K	possibly damaging	Het
Aldh3b3	C	T	19: 3,968,512	T409I	probably benign	Het
Ankrd13a	C	A	5: 114,801,717	H468Q	possibly damaging	Het
Ap2a1	A	C	7: 44,923,901		probably benign	Het
Arfgef1	A	T	1: 10,188,860	S671T	possibly damaging	Het
C1ra	G	A	6: 124,516,724	C145Y	probably damaging	Het
Catsperd	G	A	17: 56,632,335	V55M	possibly damaging	Het
Ccdc30	T	C	4: 119,359,674	N123D	possibly damaging	Het
Cdc20	A	T	4: 118,436,027	V232E	possibly damaging	Het
Cfap58	T	A	19: 47,983,542	V637E	possibly damaging	Het
Coq4	T	A	2: 29,788,355	V24E	possibly damaging	Het
Crls1	T	C	2: 132,864,142	V262A	possibly damaging	Het
Crybb1	T	C	5: 112,257,559		probably null	Het
Cutc	T	A	19: 43,755,630	N23K	probably benign	Het
Cxcl10	T	A	5: 92,347,839	I82F	probably damaging	Het
Cyp3a44	A	T	5: 145,801,314	F60L	possibly damaging	Het
Dhx9	A	G	1: 153,483,747	M35T	probably benign	Het
Dnah8	A	G	17: 30,706,386	E1265G	probably benign	Het
Dzank1	C	G	2: 144,483,407	D548H	probably damaging	Het
Eef2kmt	A	G	16: 5,249,029	V120A	probably damaging	Het
Elp4	A	G	2: 105,814,264		probably null	Het
Etl4	A	T	2: 20,807,035	I1310F	probably damaging	Het
Exoc6b	A	T	6: 84,851,927	F492I	probably damaging	Het
F2rl2	A	T	13: 95,700,782	I112F	possibly damaging	Het
Farp1	T	A	14: 121,276,304	I837N	possibly damaging	Het
Fars2	A	G	13: 36,410,146	E378G	probably damaging	Het
Fgg	A	G	3: 83,011,423	T248A	probably benign	Het
Flrt3	T	A	2: 140,660,500	T403S	probably damaging	Het
Fndc3b	C	T	3: 27,541,931	E170K	probably damaging	Het
Gm17728	A	G	17: 9,422,370	H104R	probably benign	Het
Hist2h2ab	C	A	3: 96,220,277	T121K	possibly damaging	Het
Hivep1	A	G	13: 42,160,127	T1948A	probably benign	Het
Hspa4l	T	A	3: 40,745,745	I23N	probably damaging	Het
Ighv1-75	A	G	12: 115,834,209	V31A	probably benign	Het
Kalrn	T	A	16: 34,014,084	N627I	probably damaging	Het
Lrp1b	T	G	2: 42,652,822		probably benign	Het
Lrrc36	G	A	8: 105,457,573	V480M	probably damaging	Het
Map4k3	A	T	17: 80,613,495	N534K	possibly damaging	Het
Mybpc3	C	T	2: 91,134,829	T1081I	probably benign	Het
Nfrkb	T	C	9: 31,399,298	S351P	probably damaging	Het
Nme4	A	T	17: 26,094,231	V43E	probably damaging	Het
Notch1	C	T	2: 26,476,161	E794K	probably damaging	Het
Nufip1	A	T	14: 76,126,146	K270M	probably damaging	Het
Olfr1093	A	G	2: 86,785,726		probably null	Het
Olfr1330	G	T	4: 118,893,635	G184V	probably benign	Het
Olfr390	G	T	11: 73,787,634	R232L	probably benign	Het
Olfr65	G	A	7: 103,906,638	M66I	probably benign	Het
Olfr919	A	G	9: 38,698,159	I73T	possibly damaging	Het
Pcdhb15	T	A	18: 37,473,770	Y18*	probably null	Het
Pcdhb21	A	T	18: 37,513,917	Y33F	probably benign	Het
Pds5b	T	A	5: 150,778,221	H772Q	possibly damaging	Het
Pik3r4	C	A	9: 105,667,825	H168N	probably benign	Het
Pitpnm3	A	G	11: 72,067,160	S386P	possibly damaging	Het
Plg	A	G	17: 12,395,754	H307R	probably damaging	Het
Prdm9	A	C	17: 15,562,440	D96E	probably damaging	Het
Prmt8	A	G	6: 127,768,729	S7P	probably damaging	Het
Prune2	T	C	19: 17,118,209	V359A	probably benign	Het
Pxn	A	T	5: 115,551,492	Q279L	probably benign	Het
Rarb	A	T	14: 16,443,788	C167S	probably damaging	Het
Rps6kb2	T	A	19: 4,161,134	I131F	probably damaging	Het
Sec14l3	T	A	11: 4,071,484	V219E	probably damaging	Het
Simc1	A	G	13: 54,525,404	T522A	probably benign	Het
Slc1a6	T	C	10: 78,789,091	V110A	possibly damaging	Het
Slc38a11	T	G	2: 65,361,403		probably null	Het
Snx13	T	A	12: 35,140,171	D840E	probably benign	Het
Sp100	C	A	1: 85,682,264		probably benign	Het
Spc24	G	T	9: 21,757,390	L104I	probably damaging	Het
Surf4	T	C	2: 26,933,313	N4D	probably benign	Het
Tas2r131	A	T	6: 132,957,608	D79E	probably benign	Het
Tbc1d20	T	C	2: 152,311,461	S304P	probably benign	Het
Tbrg1	T	C	9: 37,654,991		probably benign	Het
Tmem214	A	G	5: 30,871,517	N150S	probably damaging	Het
Trappc13	A	T	13: 104,150,098	I217K	probably benign	Het
Ttc41	T	A	10: 86,736,977	C738S	probably benign	Het
Ttn	T	C	2: 76,709,724	Q25979R	probably benign	Het
Tubb2b	A	T	13: 34,128,197	N204K	probably damaging	Het
Ube3a	T	A	7: 59,288,488	M713K	probably damaging	Het
Usp37	T	C	1: 74,495,811		probably benign	Het
Vegfb	T	A	19: 6,982,846	*189C	probably null	Het
Vmn2r82	A	G	10: 79,378,818	N212D	probably benign	Het
Vta1	A	T	10: 14,668,122		probably null	Het
Wdr66	A	T	5: 123,322,572	Q225L	probably benign	Het
Xdh	T	G	17: 73,913,875	I620L	possibly damaging	Het
Xpnpep3	A	G	15: 81,436,769	Y283C	probably benign	Het
Zscan18	A	G	7: 12,770,864	S609P	probably benign	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R7920:Crim1	UTSW	17	78303064	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
R8782:Crim1	UTSW	17	78200877	missense	probably damaging	1.00
R8961:Crim1	UTSW	17	78372688	missense	possibly damaging	0.65
R8971:Crim1	UTSW	17	78345980	missense	possibly damaging	0.89
R9245:Crim1	UTSW	17	78344442	missense	probably damaging	1.00
R9250:Crim1	UTSW	17	78370042	missense	probably benign
R9401:Crim1	UTSW	17	78350865	frame shift	probably null
R9402:Crim1	UTSW	17	78350865	frame shift	probably null
R9644:Crim1	UTSW	17	78280068	missense	probably damaging	1.00
R9702:Crim1	UTSW	17	78374087	missense	probably damaging	1.00
R9710:Crim1	UTSW	17	78303075	nonsense	probably null
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- GGCTTCCACTGATAGGAGATG -3'
(R):5'- GAAACGAGACCATACTGGCC -3'

Sequencing Primer
(F):5'- GACGGGAGGAAACTGTCTTC -3'
(R):5'- CAACACTTCTTCCAACAGGAGGAG -3'

Posted On

2016-12-15