Incidental Mutation 'R5635:Prune2'
ID 448698
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Name prune homolog 2
Synonyms A230083H22Rik, 6330414G02Rik, A330102H22Rik
MMRRC Submission 043286-MU
Accession Numbers

Genbank: NM_181348
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5635 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 16956118-17223932 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17118209 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 359 (V359A)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087689
AA Change: V359A

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: V359A

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Meta Mutation Damage Score 0.0683 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,218,277 M53K possibly damaging Het
Aldh3b3 C T 19: 3,968,512 T409I probably benign Het
Ankrd13a C A 5: 114,801,717 H468Q possibly damaging Het
Ap2a1 A C 7: 44,923,901 probably benign Het
Arfgef1 A T 1: 10,188,860 S671T possibly damaging Het
C1ra G A 6: 124,516,724 C145Y probably damaging Het
Catsperd G A 17: 56,632,335 V55M possibly damaging Het
Ccdc30 T C 4: 119,359,674 N123D possibly damaging Het
Cdc20 A T 4: 118,436,027 V232E possibly damaging Het
Cfap58 T A 19: 47,983,542 V637E possibly damaging Het
Coq4 T A 2: 29,788,355 V24E possibly damaging Het
Crim1 T A 17: 78,315,641 F423I probably damaging Het
Crls1 T C 2: 132,864,142 V262A possibly damaging Het
Crybb1 T C 5: 112,257,559 probably null Het
Cutc T A 19: 43,755,630 N23K probably benign Het
Cxcl10 T A 5: 92,347,839 I82F probably damaging Het
Cyp3a44 A T 5: 145,801,314 F60L possibly damaging Het
Dhx9 A G 1: 153,483,747 M35T probably benign Het
Dnah8 A G 17: 30,706,386 E1265G probably benign Het
Dzank1 C G 2: 144,483,407 D548H probably damaging Het
Eef2kmt A G 16: 5,249,029 V120A probably damaging Het
Elp4 A G 2: 105,814,264 probably null Het
Etl4 A T 2: 20,807,035 I1310F probably damaging Het
Exoc6b A T 6: 84,851,927 F492I probably damaging Het
F2rl2 A T 13: 95,700,782 I112F possibly damaging Het
Farp1 T A 14: 121,276,304 I837N possibly damaging Het
Fars2 A G 13: 36,410,146 E378G probably damaging Het
Fgg A G 3: 83,011,423 T248A probably benign Het
Flrt3 T A 2: 140,660,500 T403S probably damaging Het
Fndc3b C T 3: 27,541,931 E170K probably damaging Het
Gm17728 A G 17: 9,422,370 H104R probably benign Het
Hist2h2ab C A 3: 96,220,277 T121K possibly damaging Het
Hivep1 A G 13: 42,160,127 T1948A probably benign Het
Hspa4l T A 3: 40,745,745 I23N probably damaging Het
Ighv1-75 A G 12: 115,834,209 V31A probably benign Het
Kalrn T A 16: 34,014,084 N627I probably damaging Het
Lrp1b T G 2: 42,652,822 probably benign Het
Lrrc36 G A 8: 105,457,573 V480M probably damaging Het
Map4k3 A T 17: 80,613,495 N534K possibly damaging Het
Mybpc3 C T 2: 91,134,829 T1081I probably benign Het
Nfrkb T C 9: 31,399,298 S351P probably damaging Het
Nme4 A T 17: 26,094,231 V43E probably damaging Het
Notch1 C T 2: 26,476,161 E794K probably damaging Het
Nufip1 A T 14: 76,126,146 K270M probably damaging Het
Olfr1093 A G 2: 86,785,726 probably null Het
Olfr1330 G T 4: 118,893,635 G184V probably benign Het
Olfr390 G T 11: 73,787,634 R232L probably benign Het
Olfr65 G A 7: 103,906,638 M66I probably benign Het
Olfr919 A G 9: 38,698,159 I73T possibly damaging Het
Pcdhb15 T A 18: 37,473,770 Y18* probably null Het
Pcdhb21 A T 18: 37,513,917 Y33F probably benign Het
Pds5b T A 5: 150,778,221 H772Q possibly damaging Het
Pik3r4 C A 9: 105,667,825 H168N probably benign Het
Pitpnm3 A G 11: 72,067,160 S386P possibly damaging Het
Plg A G 17: 12,395,754 H307R probably damaging Het
Prdm9 A C 17: 15,562,440 D96E probably damaging Het
Prmt8 A G 6: 127,768,729 S7P probably damaging Het
Pxn A T 5: 115,551,492 Q279L probably benign Het
Rarb A T 14: 16,443,788 C167S probably damaging Het
Rps6kb2 T A 19: 4,161,134 I131F probably damaging Het
Sec14l3 T A 11: 4,071,484 V219E probably damaging Het
Simc1 A G 13: 54,525,404 T522A probably benign Het
Slc1a6 T C 10: 78,789,091 V110A possibly damaging Het
Slc38a11 T G 2: 65,361,403 probably null Het
Snx13 T A 12: 35,140,171 D840E probably benign Het
Sp100 C A 1: 85,682,264 probably benign Het
Spc24 G T 9: 21,757,390 L104I probably damaging Het
Surf4 T C 2: 26,933,313 N4D probably benign Het
Tas2r131 A T 6: 132,957,608 D79E probably benign Het
Tbc1d20 T C 2: 152,311,461 S304P probably benign Het
Tbrg1 T C 9: 37,654,991 probably benign Het
Tmem214 A G 5: 30,871,517 N150S probably damaging Het
Trappc13 A T 13: 104,150,098 I217K probably benign Het
Ttc41 T A 10: 86,736,977 C738S probably benign Het
Ttn T C 2: 76,709,724 Q25979R probably benign Het
Tubb2b A T 13: 34,128,197 N204K probably damaging Het
Ube3a T A 7: 59,288,488 M713K probably damaging Het
Usp37 T C 1: 74,495,811 probably benign Het
Vegfb T A 19: 6,982,846 *189C probably null Het
Vmn2r82 A G 10: 79,378,818 N212D probably benign Het
Vta1 A T 10: 14,668,122 probably null Het
Wdr66 A T 5: 123,322,572 Q225L probably benign Het
Xdh T G 17: 73,913,875 I620L possibly damaging Het
Xpnpep3 A G 15: 81,436,769 Y283C probably benign Het
Zscan18 A G 7: 12,770,864 S609P probably benign Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17168344 critical splice donor site probably null
IGL00848:Prune2 APN 19 17119118 missense probably damaging 1.00
IGL00862:Prune2 APN 19 17119349 missense probably benign 0.41
IGL00915:Prune2 APN 19 17016253 missense probably damaging 1.00
IGL01084:Prune2 APN 19 17118209 missense probably benign 0.19
IGL01109:Prune2 APN 19 17123879 missense probably benign 0.03
IGL01372:Prune2 APN 19 17125069 missense probably damaging 1.00
IGL01650:Prune2 APN 19 17168292 missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17123903 missense possibly damaging 0.50
IGL01812:Prune2 APN 19 17003777 missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17118638 missense probably benign 0.00
IGL02195:Prune2 APN 19 17119557 missense probably benign 0.00
IGL02502:Prune2 APN 19 17123881 missense probably benign 0.00
IGL02569:Prune2 APN 19 17178859 missense probably damaging 0.99
IGL02693:Prune2 APN 19 17124491 missense probably benign 0.03
IGL02737:Prune2 APN 19 17193411 nonsense probably null
IGL02794:Prune2 APN 19 17119361 missense probably benign 0.19
IGL02985:Prune2 APN 19 17016359 critical splice donor site probably null
IGL03349:Prune2 APN 19 17123346 missense probably damaging 1.00
3-1:Prune2 UTSW 19 17125282 missense probably benign 0.00
R0060:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17122610 missense probably benign 0.00
R0277:Prune2 UTSW 19 17121389 missense probably damaging 0.99
R0321:Prune2 UTSW 19 17120927 missense possibly damaging 0.78
R0321:Prune2 UTSW 19 17122454 missense probably benign 0.39
R0374:Prune2 UTSW 19 17120910 missense probably benign 0.00
R0380:Prune2 UTSW 19 17124007 missense probably damaging 1.00
R0396:Prune2 UTSW 19 17123080 missense probably benign 0.35
R0408:Prune2 UTSW 19 17122310 missense probably benign 0.00
R0421:Prune2 UTSW 19 17123311 missense probably benign 0.02
R0480:Prune2 UTSW 19 17006792 splice site probably benign
R0531:Prune2 UTSW 19 17006753 missense probably damaging 1.00
R0546:Prune2 UTSW 19 17020666 splice site probably benign
R0554:Prune2 UTSW 19 17125218 nonsense probably null
R0659:Prune2 UTSW 19 17122835 missense probably damaging 1.00
R0699:Prune2 UTSW 19 17123955 missense probably damaging 1.00
R0781:Prune2 UTSW 19 17125222 missense probably benign
R1110:Prune2 UTSW 19 17125222 missense probably benign
R1178:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1181:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1337:Prune2 UTSW 19 17119607 missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17212317 missense probably benign 0.40
R1385:Prune2 UTSW 19 17124948 missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17120651 missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17125010 missense probably benign 0.01
R1756:Prune2 UTSW 19 17123704 missense probably benign 0.01
R1765:Prune2 UTSW 19 17125598 missense probably damaging 1.00
R1782:Prune2 UTSW 19 17122173 missense probably benign 0.00
R1817:Prune2 UTSW 19 17122081 missense probably benign 0.00
R1838:Prune2 UTSW 19 17199878 missense probably damaging 1.00
R1851:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1852:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1866:Prune2 UTSW 19 17123492 missense probably damaging 1.00
R1911:Prune2 UTSW 19 17113674 missense probably benign 0.02
R1983:Prune2 UTSW 19 17020642 missense probably damaging 0.97
R2014:Prune2 UTSW 19 17120523 missense probably damaging 1.00
R2066:Prune2 UTSW 19 17120678 missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17119745 missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17208238 missense probably damaging 1.00
R2128:Prune2 UTSW 19 17122422 missense probably benign 0.00
R2165:Prune2 UTSW 19 17120182 missense probably benign 0.19
R2241:Prune2 UTSW 19 17123092 missense probably damaging 0.96
R2278:Prune2 UTSW 19 17118555 missense possibly damaging 0.93
R2504:Prune2 UTSW 19 17000036 missense probably damaging 1.00
R2508:Prune2 UTSW 19 17122622 missense probably benign 0.43
R3055:Prune2 UTSW 19 17125043 missense probably damaging 0.98
R3086:Prune2 UTSW 19 17121413 missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3105:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3547:Prune2 UTSW 19 17124348 missense probably damaging 0.96
R3702:Prune2 UTSW 19 17178871 missense probably damaging 1.00
R3753:Prune2 UTSW 19 17125454 missense probably benign 0.38
R3933:Prune2 UTSW 19 17123954 missense probably damaging 1.00
R3935:Prune2 UTSW 19 17199786 missense probably damaging 1.00
R4022:Prune2 UTSW 19 17000020 missense probably damaging 1.00
R4042:Prune2 UTSW 19 17003826 critical splice donor site probably null
R4164:Prune2 UTSW 19 17003734 missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17121910 missense probably benign 0.00
R4642:Prune2 UTSW 19 17020655 critical splice donor site probably null
R4661:Prune2 UTSW 19 17000023 missense probably damaging 1.00
R4666:Prune2 UTSW 19 17120188 nonsense probably null
R4823:Prune2 UTSW 19 17120504 missense probably damaging 1.00
R4897:Prune2 UTSW 19 17121855 missense probably benign 0.03
R4922:Prune2 UTSW 19 17122752 missense probably benign 0.00
R4962:Prune2 UTSW 19 17122273 missense probably benign 0.11
R5026:Prune2 UTSW 19 17199142 missense probably damaging 1.00
R5042:Prune2 UTSW 19 17119797 missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17199910 missense probably damaging 1.00
R5133:Prune2 UTSW 19 17003631 missense probably damaging 1.00
R5184:Prune2 UTSW 19 17216357 missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5339:Prune2 UTSW 19 17120872 missense probably damaging 1.00
R5363:Prune2 UTSW 19 17118266 missense probably damaging 1.00
R5382:Prune2 UTSW 19 17003659 missense probably damaging 1.00
R5436:Prune2 UTSW 19 17020643 missense probably damaging 1.00
R5480:Prune2 UTSW 19 17120947 missense possibly damaging 0.66
R5678:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5814:Prune2 UTSW 19 17016361 splice site probably null
R5894:Prune2 UTSW 19 17121391 missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17118716 missense probably benign 0.35
R6207:Prune2 UTSW 19 17118116 missense probably damaging 1.00
R6218:Prune2 UTSW 19 17121562 missense probably benign 0.00
R6573:Prune2 UTSW 19 17121157 missense probably damaging 1.00
R6573:Prune2 UTSW 19 17121158 missense possibly damaging 0.61
R6734:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R6805:Prune2 UTSW 19 17120590 missense probably benign
R6837:Prune2 UTSW 19 17178928 missense probably damaging 1.00
R6850:Prune2 UTSW 19 17122188 missense probably benign 0.00
R6858:Prune2 UTSW 19 17118106 missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17123228 missense probably damaging 1.00
R6954:Prune2 UTSW 19 17000021 missense probably damaging 1.00
R7098:Prune2 UTSW 19 17120602 missense probably benign 0.39
R7102:Prune2 UTSW 19 17121213 missense probably benign 0.24
R7246:Prune2 UTSW 19 17121368 missense probably damaging 0.99
R7284:Prune2 UTSW 19 17119886 missense probably damaging 1.00
R7295:Prune2 UTSW 19 17119897 missense probably benign 0.01
R7371:Prune2 UTSW 19 17119370 missense probably benign 0.02
R7651:Prune2 UTSW 19 17120408 missense probably damaging 1.00
R7830:Prune2 UTSW 19 17122674 missense probably benign 0.21
R7872:Prune2 UTSW 19 17119434 missense probably benign 0.05
R7881:Prune2 UTSW 19 17123029 missense possibly damaging 0.50
R7966:Prune2 UTSW 19 17178859 missense probably damaging 0.99
R7969:Prune2 UTSW 19 17201670 missense probably damaging 0.98
R8092:Prune2 UTSW 19 17119993 missense probably damaging 1.00
R8110:Prune2 UTSW 19 17120719 missense probably benign 0.22
R8115:Prune2 UTSW 19 17123924 missense probably benign 0.02
R8129:Prune2 UTSW 19 17118836 missense probably benign 0.01
R8169:Prune2 UTSW 19 17125091 missense probably benign 0.10
R8171:Prune2 UTSW 19 17120518 missense probably damaging 1.00
R8176:Prune2 UTSW 19 17118292 missense probably damaging 1.00
R8200:Prune2 UTSW 19 17124973 missense probably benign 0.01
R8217:Prune2 UTSW 19 17120116 missense probably benign 0.01
R8258:Prune2 UTSW 19 17212308 missense unknown
R8259:Prune2 UTSW 19 17212308 missense unknown
R8289:Prune2 UTSW 19 17123009 missense probably benign 0.43
R8329:Prune2 UTSW 19 17121265 missense probably benign 0.02
R8342:Prune2 UTSW 19 17125663 missense probably benign 0.01
R8558:Prune2 UTSW 19 17122238 missense probably damaging 0.98
R8732:Prune2 UTSW 19 17120405 missense probably damaging 1.00
R8743:Prune2 UTSW 19 17119556 missense probably benign 0.22
R8769:Prune2 UTSW 19 17123078 missense probably damaging 0.96
R8862:Prune2 UTSW 19 17120146 missense probably benign 0.04
R8936:Prune2 UTSW 19 17121835 missense probably benign 0.24
R9040:Prune2 UTSW 19 17120627 missense probably damaging 1.00
R9084:Prune2 UTSW 19 17120377 missense probably damaging 1.00
R9224:Prune2 UTSW 19 17120029 missense probably damaging 1.00
R9273:Prune2 UTSW 19 17118326 missense possibly damaging 0.74
R9275:Prune2 UTSW 19 17123780 missense probably benign 0.06
R9278:Prune2 UTSW 19 17123780 missense probably benign 0.06
R9290:Prune2 UTSW 19 17168327 missense probably benign 0.41
R9305:Prune2 UTSW 19 17120261 missense probably benign 0.14
R9317:Prune2 UTSW 19 17121670 missense probably benign 0.00
R9354:Prune2 UTSW 19 17122622 missense probably benign 0.43
R9373:Prune2 UTSW 19 17122138 missense probably benign
R9394:Prune2 UTSW 19 17003689 missense probably damaging 1.00
R9405:Prune2 UTSW 19 17216344 missense probably damaging 0.99
R9476:Prune2 UTSW 19 17119342 missense possibly damaging 0.64
R9532:Prune2 UTSW 19 17122430 missense probably benign 0.00
X0019:Prune2 UTSW 19 17121517 missense probably benign 0.16
X0028:Prune2 UTSW 19 17122885 missense probably damaging 1.00
X0064:Prune2 UTSW 19 17122375 missense probably damaging 1.00
X0066:Prune2 UTSW 19 17118790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAAAATGCAAGGGCCATCTG -3'
(R):5'- TATGTTGCCATCCGCCTGAG -3'

Sequencing Primer
(F):5'- AAGGGCCATCTGCATGCTC -3'
(R):5'- ATCCGCCTGAGCTTGGTTAGAATC -3'
Posted On 2016-12-15