Incidental Mutation 'R5775:Arpc2'
ID448701
Institutional Source Beutler Lab
Gene Symbol Arpc2
Ensembl Gene ENSMUSG00000006304
Gene Nameactin related protein 2/3 complex, subunit 2
Synonymsp34-Arc, 2210023N03Rik
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74236084-74268209 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 74255949 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006467] [ENSMUST00000006467] [ENSMUST00000113819] [ENSMUST00000113819] [ENSMUST00000113819] [ENSMUST00000113820] [ENSMUST00000113820] [ENSMUST00000113820]
Predicted Effect probably null
Transcript: ENSMUST00000006467
SMART Domains Protein: ENSMUSP00000006467
Gene: ENSMUSG00000006304

DomainStartEndE-ValueType
Pfam:P34-Arc 57 284 3.7e-107 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000006467
SMART Domains Protein: ENSMUSP00000006467
Gene: ENSMUSG00000006304

DomainStartEndE-ValueType
Pfam:P34-Arc 57 284 3.7e-107 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113819
SMART Domains Protein: ENSMUSP00000109450
Gene: ENSMUSG00000006304

DomainStartEndE-ValueType
Pfam:P34-Arc 40 270 4.3e-107 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113819
SMART Domains Protein: ENSMUSP00000109450
Gene: ENSMUSG00000006304

DomainStartEndE-ValueType
Pfam:P34-Arc 40 270 4.3e-107 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113819
SMART Domains Protein: ENSMUSP00000109450
Gene: ENSMUSG00000006304

DomainStartEndE-ValueType
Pfam:P34-Arc 40 270 4.3e-107 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113820
SMART Domains Protein: ENSMUSP00000109451
Gene: ENSMUSG00000006304

DomainStartEndE-ValueType
Pfam:P34-Arc 56 286 4.2e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113820
SMART Domains Protein: ENSMUSP00000109451
Gene: ENSMUSG00000006304

DomainStartEndE-ValueType
Pfam:P34-Arc 56 286 4.2e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113820
SMART Domains Protein: ENSMUSP00000109451
Gene: ENSMUSG00000006304

DomainStartEndE-ValueType
Pfam:P34-Arc 56 286 4.2e-106 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p34 subunit, has yet to be determined. Two alternatively spliced variants have been characterized to date. Additional alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Arpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Arpc2 APN 1 74248179 missense probably benign
R0220:Arpc2 UTSW 1 74248134 missense probably damaging 1.00
R0364:Arpc2 UTSW 1 74236887 missense probably null
R1695:Arpc2 UTSW 1 74248232 missense probably damaging 0.97
R4183:Arpc2 UTSW 1 74248163 missense probably damaging 0.99
R5144:Arpc2 UTSW 1 74248208 missense probably damaging 1.00
R5438:Arpc2 UTSW 1 74236836 missense probably null 1.00
R6017:Arpc2 UTSW 1 74262486 missense probably benign
R7173:Arpc2 UTSW 1 74264372 missense probably damaging 1.00
R7683:Arpc2 UTSW 1 74263814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCCCAGATAATTCAGACACCATAG -3'
(R):5'- TCTGTTACCAATTGCCCAGGC -3'

Sequencing Primer
(F):5'- GATAATTCAGACACCATAGGCTAAAC -3'
(R):5'- ACCTGGGACCTTATGCATATCAGG -3'
Posted On2016-12-15