Incidental Mutation 'R5775:Olfr1173'
ID448706
Institutional Source Beutler Lab
Gene Symbol Olfr1173
Ensembl Gene ENSMUSG00000075132
Gene Nameolfactory receptor 1173
SynonymsGA_x6K02T2Q125-49759783-49758845, MOR174-20_p
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88273040-88279875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88274701 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 116 (M116K)
Ref Sequence ENSEMBL: ENSMUSP00000149617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099830] [ENSMUST00000216887]
Predicted Effect probably damaging
Transcript: ENSMUST00000099830
AA Change: M116K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097418
Gene: ENSMUSG00000075132
AA Change: M116K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-46 PFAM
Pfam:7tm_1 39 288 1.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216887
AA Change: M116K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Olfr1173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Olfr1173 APN 2 88274716 missense probably damaging 1.00
IGL01751:Olfr1173 APN 2 88274633 missense possibly damaging 0.60
IGL02009:Olfr1173 APN 2 88274712 missense probably benign 0.06
IGL02148:Olfr1173 APN 2 88274222 missense possibly damaging 0.94
IGL02833:Olfr1173 APN 2 88274432 missense probably benign
IGL03001:Olfr1173 APN 2 88274845 missense probably damaging 1.00
R0471:Olfr1173 UTSW 2 88274215 missense possibly damaging 0.95
R2136:Olfr1173 UTSW 2 88274240 missense probably damaging 0.98
R2141:Olfr1173 UTSW 2 88275010 missense probably benign 0.30
R3957:Olfr1173 UTSW 2 88275004 missense probably damaging 1.00
R4801:Olfr1173 UTSW 2 88274879 missense probably damaging 1.00
R4802:Olfr1173 UTSW 2 88274879 missense probably damaging 1.00
R5266:Olfr1173 UTSW 2 88274221 missense possibly damaging 0.49
R5371:Olfr1173 UTSW 2 88274632 missense probably damaging 1.00
R7222:Olfr1173 UTSW 2 88274465 missense probably benign 0.00
R7493:Olfr1173 UTSW 2 88275101 start gained probably benign
R7503:Olfr1173 UTSW 2 88274695 missense probably damaging 1.00
R7586:Olfr1173 UTSW 2 88274450 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATCAATGATGCCAGGTTCAC -3'
(R):5'- CACTCTGGTAGGAAATGTAGGC -3'

Sequencing Primer
(F):5'- TGATGCCAGGTTCACAATAAGAC -3'
(R):5'- TGGTCAGAAGGATCAACCCTAAGC -3'
Posted On2016-12-15