Incidental Mutation 'R5775:Cep250'
ID448707
Institutional Source Beutler Lab
Gene Symbol Cep250
Ensembl Gene ENSMUSG00000038241
Gene Namecentrosomal protein 250
SynonymsCep2, Inmp, B230210E21Rik
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155956458-155998900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 155969374 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 380 (D380A)
Ref Sequence ENSEMBL: ENSMUSP00000038255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109618] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000151569]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039994
AA Change: D380A

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: D380A

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 4.2e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 327 N/A INTRINSIC
internal_repeat_1 444 460 1.47e-18 PROSPERO
internal_repeat_1 465 481 1.47e-18 PROSPERO
low complexity region 495 506 N/A INTRINSIC
low complexity region 557 580 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 669 677 N/A INTRINSIC
low complexity region 688 703 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 990 1007 N/A INTRINSIC
low complexity region 1043 1053 N/A INTRINSIC
low complexity region 1138 1143 N/A INTRINSIC
low complexity region 1182 1195 N/A INTRINSIC
coiled coil region 1257 1687 N/A INTRINSIC
low complexity region 1872 1895 N/A INTRINSIC
low complexity region 1919 1933 N/A INTRINSIC
low complexity region 1941 1960 N/A INTRINSIC
internal_repeat_2 2002 2052 3.9e-6 PROSPERO
coiled coil region 2068 2169 N/A INTRINSIC
coiled coil region 2196 2217 N/A INTRINSIC
coiled coil region 2251 2310 N/A INTRINSIC
low complexity region 2325 2338 N/A INTRINSIC
coiled coil region 2340 2366 N/A INTRINSIC
low complexity region 2379 2388 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094421
AA Change: D381A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: D381A

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 5.4e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
coiled coil region 400 1165 N/A INTRINSIC
coiled coil region 1237 1667 N/A INTRINSIC
low complexity region 1852 1875 N/A INTRINSIC
low complexity region 1899 1913 N/A INTRINSIC
low complexity region 1921 1940 N/A INTRINSIC
internal_repeat_1 1982 2032 3.35e-6 PROSPERO
coiled coil region 2048 2149 N/A INTRINSIC
coiled coil region 2176 2197 N/A INTRINSIC
coiled coil region 2231 2290 N/A INTRINSIC
low complexity region 2305 2318 N/A INTRINSIC
coiled coil region 2320 2346 N/A INTRINSIC
low complexity region 2359 2368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109618
SMART Domains Protein: ENSMUSP00000105247
Gene: ENSMUSG00000038241

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 2.3e-57 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 317 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109619
AA Change: D381A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: D381A

DomainStartEndE-ValueType
Pfam:Rootletin 38 214 4.1e-60 PFAM
low complexity region 215 225 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
internal_repeat_1 445 461 1.51e-18 PROSPERO
internal_repeat_1 466 482 1.51e-18 PROSPERO
low complexity region 496 507 N/A INTRINSIC
low complexity region 558 581 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
low complexity region 670 678 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 897 915 N/A INTRINSIC
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1139 1144 N/A INTRINSIC
low complexity region 1183 1196 N/A INTRINSIC
coiled coil region 1258 1688 N/A INTRINSIC
low complexity region 1873 1896 N/A INTRINSIC
low complexity region 1920 1934 N/A INTRINSIC
low complexity region 1942 1961 N/A INTRINSIC
internal_repeat_2 2003 2053 3.95e-6 PROSPERO
coiled coil region 2069 2170 N/A INTRINSIC
coiled coil region 2197 2218 N/A INTRINSIC
coiled coil region 2252 2311 N/A INTRINSIC
low complexity region 2326 2339 N/A INTRINSIC
coiled coil region 2341 2367 N/A INTRINSIC
low complexity region 2380 2389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149905
Predicted Effect probably benign
Transcript: ENSMUST00000151569
AA Change: D380A

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114426
Gene: ENSMUSG00000038241
AA Change: D380A

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 1.3e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 327 N/A INTRINSIC
internal_repeat_1 444 460 1.16e-14 PROSPERO
internal_repeat_1 465 481 1.16e-14 PROSPERO
low complexity region 495 506 N/A INTRINSIC
low complexity region 557 580 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 669 677 N/A INTRINSIC
low complexity region 688 703 N/A INTRINSIC
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Cep250
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Cep250 APN 2 155991329 missense probably benign 0.00
IGL01077:Cep250 APN 2 155962134 missense probably damaging 1.00
IGL01084:Cep250 APN 2 155998393 missense probably benign 0.00
IGL01400:Cep250 APN 2 155998291 missense possibly damaging 0.78
IGL01570:Cep250 APN 2 155967663 splice site probably benign
IGL01583:Cep250 APN 2 155976149 missense probably damaging 0.99
IGL01590:Cep250 APN 2 155992317 missense possibly damaging 0.80
IGL01647:Cep250 APN 2 155983376 missense probably benign 0.02
IGL01959:Cep250 APN 2 155983359 missense possibly damaging 0.63
IGL02066:Cep250 APN 2 155976521 missense probably damaging 1.00
IGL02219:Cep250 APN 2 155991594 missense probably benign 0.26
IGL02322:Cep250 APN 2 155990328 missense probably damaging 1.00
IGL02728:Cep250 APN 2 155983278 unclassified probably benign
IGL02955:Cep250 APN 2 155975756 missense probably benign 0.01
IGL03369:Cep250 APN 2 155990271 missense probably benign 0.00
R0366:Cep250 UTSW 2 155988401 missense probably benign 0.00
R0403:Cep250 UTSW 2 155992349 missense probably damaging 0.99
R0441:Cep250 UTSW 2 155972004 missense possibly damaging 0.82
R0482:Cep250 UTSW 2 155964974 splice site probably benign
R0507:Cep250 UTSW 2 155992532 missense possibly damaging 0.60
R0614:Cep250 UTSW 2 155970097 nonsense probably null
R0855:Cep250 UTSW 2 155964111 missense probably damaging 1.00
R0973:Cep250 UTSW 2 155964289 splice site probably benign
R1137:Cep250 UTSW 2 155990840 missense probably benign 0.05
R1270:Cep250 UTSW 2 155990681 missense probably benign 0.01
R1313:Cep250 UTSW 2 155972079 missense probably damaging 0.98
R1313:Cep250 UTSW 2 155972079 missense probably damaging 0.98
R1470:Cep250 UTSW 2 155991075 missense probably damaging 0.99
R1470:Cep250 UTSW 2 155991075 missense probably damaging 0.99
R1703:Cep250 UTSW 2 155965546 missense probably benign 0.23
R1705:Cep250 UTSW 2 155963786 missense probably damaging 1.00
R1740:Cep250 UTSW 2 155973356 missense probably damaging 0.99
R1796:Cep250 UTSW 2 155992187 missense possibly damaging 0.88
R1897:Cep250 UTSW 2 155976095 missense probably damaging 1.00
R1900:Cep250 UTSW 2 155985374 critical splice donor site probably null
R1958:Cep250 UTSW 2 155976381 splice site probably null
R1974:Cep250 UTSW 2 155989504 missense probably damaging 0.96
R2015:Cep250 UTSW 2 155981453 missense probably damaging 0.96
R2033:Cep250 UTSW 2 155970892 missense probably damaging 0.99
R2224:Cep250 UTSW 2 155991817 missense possibly damaging 0.94
R2266:Cep250 UTSW 2 155976170 missense probably benign 0.13
R2278:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2332:Cep250 UTSW 2 155990607 missense probably damaging 1.00
R2364:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2366:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2367:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2385:Cep250 UTSW 2 155974341 missense probably damaging 1.00
R2830:Cep250 UTSW 2 155983316 missense probably benign 0.00
R2895:Cep250 UTSW 2 155992122 missense probably benign 0.00
R2965:Cep250 UTSW 2 155994878 missense probably benign 0.44
R2966:Cep250 UTSW 2 155994878 missense probably benign 0.44
R3016:Cep250 UTSW 2 155991288 missense probably damaging 1.00
R3052:Cep250 UTSW 2 155991048 missense probably damaging 0.99
R3424:Cep250 UTSW 2 155981461 missense probably benign 0.02
R3930:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4085:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4087:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4088:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4090:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4110:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4355:Cep250 UTSW 2 155991525 missense probably damaging 1.00
R4601:Cep250 UTSW 2 155962053 missense probably benign 0.10
R4721:Cep250 UTSW 2 155970199 missense probably damaging 1.00
R4995:Cep250 UTSW 2 155988316 missense probably damaging 1.00
R5053:Cep250 UTSW 2 155962928 missense possibly damaging 0.77
R5090:Cep250 UTSW 2 155976404 missense probably damaging 1.00
R5744:Cep250 UTSW 2 155981474 missense possibly damaging 0.60
R5986:Cep250 UTSW 2 155979277 missense probably damaging 1.00
R6112:Cep250 UTSW 2 155994583 missense possibly damaging 0.95
R6152:Cep250 UTSW 2 155981438 missense possibly damaging 0.94
R6823:Cep250 UTSW 2 155981459 missense probably benign 0.02
R6859:Cep250 UTSW 2 155992526 missense probably benign 0.24
R6900:Cep250 UTSW 2 155996270 critical splice acceptor site probably null
R7107:Cep250 UTSW 2 155995394 missense probably benign 0.00
R7131:Cep250 UTSW 2 155965077 missense probably damaging 1.00
R7178:Cep250 UTSW 2 155973455 nonsense probably null
R7241:Cep250 UTSW 2 155991552 missense probably benign 0.20
R7264:Cep250 UTSW 2 155979151 missense probably damaging 0.99
R7290:Cep250 UTSW 2 155992762 missense probably benign 0.03
R7367:Cep250 UTSW 2 155969307 missense probably benign 0.00
R7397:Cep250 UTSW 2 155981411 missense probably damaging 0.99
R7768:Cep250 UTSW 2 155986009 missense
R7823:Cep250 UTSW 2 155965416 missense possibly damaging 0.89
X0061:Cep250 UTSW 2 155961985 missense probably benign 0.05
Z1177:Cep250 UTSW 2 155976467 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCATGTGGCTAACTCTGTCC -3'
(R):5'- CCAGGCCATTACATGCATGC -3'

Sequencing Primer
(F):5'- GTGGCTAACTCTGTCCTTATATGAC -3'
(R):5'- AGGCCATTACATGCATGCACTTG -3'
Posted On2016-12-15