Incidental Mutation 'R5775:Kcns1'
ID448708
Institutional Source Beutler Lab
Gene Symbol Kcns1
Ensembl Gene ENSMUSG00000040164
Gene NameK+ voltage-gated channel, subfamily S, 1
SynonymsKv9.1
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5775 (G1)
Quality Score218
Status Validated
Chromosome2
Chromosomal Location164163619-164171113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164164766 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 426 (I426V)
Ref Sequence ENSEMBL: ENSMUSP00000038901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045196]
Predicted Effect probably damaging
Transcript: ENSMUST00000045196
AA Change: I426V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038901
Gene: ENSMUSG00000040164
AA Change: I426V

DomainStartEndE-ValueType
BTB 19 128 7.07e-7 SMART
low complexity region 160 175 N/A INTRINSIC
Pfam:Ion_trans 188 439 2e-44 PFAM
Pfam:Ion_trans_2 349 433 5e-13 PFAM
low complexity region 455 468 N/A INTRINSIC
Meta Mutation Damage Score 0.1141 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Kcns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Kcns1 UTSW 2 164168643 missense probably benign 0.00
R0135:Kcns1 UTSW 2 164164955 missense possibly damaging 0.90
R0241:Kcns1 UTSW 2 164168380 missense probably damaging 1.00
R1966:Kcns1 UTSW 2 164168535 missense probably damaging 1.00
R2877:Kcns1 UTSW 2 164164762 missense probably damaging 1.00
R2878:Kcns1 UTSW 2 164164762 missense probably damaging 1.00
R3157:Kcns1 UTSW 2 164164945 missense probably damaging 1.00
R4013:Kcns1 UTSW 2 164168257 missense probably damaging 1.00
R4451:Kcns1 UTSW 2 164168678 missense possibly damaging 0.46
R4873:Kcns1 UTSW 2 164168101 missense probably damaging 1.00
R4875:Kcns1 UTSW 2 164168101 missense probably damaging 1.00
R5270:Kcns1 UTSW 2 164168329 missense probably benign 0.37
R5493:Kcns1 UTSW 2 164167979 missense probably benign 0.02
R6931:Kcns1 UTSW 2 164164838 missense probably damaging 0.99
R7689:Kcns1 UTSW 2 164168321 missense probably damaging 1.00
Z1176:Kcns1 UTSW 2 164168633 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGAGATTTTGCAGGCTCCCG -3'
(R):5'- GCATCTTACTGCTGTACCTGG -3'

Sequencing Primer
(F):5'- AGCTTGGGTCTCCAGGTC -3'
(R):5'- TACTGCTGTACCTGGCCGTG -3'
Posted On2016-12-15