Incidental Mutation 'R5775:Sec24d'
ID 448711
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name SEC24 homolog D, COPII coat complex component
Synonyms LOC383951, 2310020L09Rik
MMRRC Submission 043374-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5775 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 123061104-123159290 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 123084109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 96 (A96V)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably benign
Transcript: ENSMUST00000047923
AA Change: A96V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: A96V

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197291
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,509,886 (GRCm39) D753G possibly damaging Het
Arpc2 T A 1: 74,295,108 (GRCm39) probably null Het
Atxn2 C T 5: 121,951,512 (GRCm39) T619M probably damaging Het
Cacna1s T C 1: 136,035,860 (GRCm39) Y1120H probably damaging Het
Calm5 T C 13: 3,904,435 (GRCm39) L20S probably damaging Het
Carmil1 T C 13: 24,460,520 (GRCm39) I20V probably benign Het
Cd177 T C 7: 24,451,693 (GRCm39) E441G probably damaging Het
Cd63 T A 10: 128,746,299 (GRCm39) C9S probably damaging Het
Cep250 A C 2: 155,811,294 (GRCm39) D380A possibly damaging Het
Col5a3 G T 9: 20,712,368 (GRCm39) P509Q unknown Het
Cyp11b2 A G 15: 74,725,327 (GRCm39) V264A probably benign Het
Dennd6a T A 14: 26,340,528 (GRCm39) L214* probably null Het
Dna2 A G 10: 62,785,021 (GRCm39) N46S possibly damaging Het
Elovl1 G A 4: 118,288,094 (GRCm39) V77I probably benign Het
Eml1 A T 12: 108,472,813 (GRCm39) Y207F probably damaging Het
Epha6 C T 16: 59,639,357 (GRCm39) R839Q possibly damaging Het
Erlec1 A T 11: 30,893,848 (GRCm39) S105T probably benign Het
Esp3 T A 17: 40,944,468 (GRCm39) S37T possibly damaging Het
Foxh1 G A 15: 76,554,049 (GRCm39) A8V probably benign Het
Fut1 A C 7: 45,268,886 (GRCm39) D280A probably damaging Het
Gm13998 G T 2: 119,708,892 (GRCm39) noncoding transcript Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
H2az1 T C 3: 137,571,380 (GRCm39) Y61H probably damaging Het
Kcns1 T C 2: 164,006,686 (GRCm39) I426V probably damaging Het
Kdm4c T G 4: 74,277,668 (GRCm39) V774G probably damaging Het
Mrc2 G A 11: 105,228,639 (GRCm39) V673I probably benign Het
Mtnr1b G A 9: 15,774,168 (GRCm39) A297V possibly damaging Het
Or5d43 A T 2: 88,105,045 (GRCm39) M116K probably damaging Het
Or8b40 A T 9: 38,027,423 (GRCm39) E110D probably damaging Het
Osbpl5 A T 7: 143,258,266 (GRCm39) V346D probably benign Het
Pdzrn4 A T 15: 92,655,562 (GRCm39) E485V probably damaging Het
Pgpep1 G A 8: 71,105,101 (GRCm39) T53M probably damaging Het
Pigo T C 4: 43,023,475 (GRCm39) D233G probably damaging Het
Pmm1 A T 15: 81,836,156 (GRCm39) I152N probably benign Het
Pot1a A T 6: 25,757,297 (GRCm39) probably null Het
Ppp1r12b G T 1: 134,803,780 (GRCm39) L460I probably benign Het
Prrc2a T C 17: 35,377,463 (GRCm39) D565G unknown Het
Psd C A 19: 46,303,211 (GRCm39) E724* probably null Het
Rasa2 C T 9: 96,459,521 (GRCm39) probably null Het
Rsbn1 A T 3: 103,869,888 (GRCm39) Q783L possibly damaging Het
Ryr2 T C 13: 11,784,848 (GRCm39) Y1035C probably damaging Het
Sec61a2 A T 2: 5,887,585 (GRCm39) probably null Het
Sec62 A G 3: 30,847,436 (GRCm39) probably benign Het
Tcstv2a T A 13: 120,725,475 (GRCm39) C46* probably null Het
Tmem132b T A 5: 125,715,394 (GRCm39) probably null Het
Tnip3 A G 6: 65,591,741 (GRCm39) S247G probably benign Het
Traf3 A G 12: 111,219,162 (GRCm39) K263R possibly damaging Het
Tubgcp3 A T 8: 12,675,056 (GRCm39) I713N probably damaging Het
Unc5c A G 3: 141,534,281 (GRCm39) E860G probably damaging Het
Usp44 A G 10: 93,681,840 (GRCm39) S97G possibly damaging Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Vps37a A G 8: 40,982,160 (GRCm39) H109R probably damaging Het
Wfikkn2 G T 11: 94,129,114 (GRCm39) D342E probably benign Het
Zfp354b A T 11: 50,813,647 (GRCm39) F426Y probably benign Het
Zfp462 C A 4: 55,010,590 (GRCm39) T852N probably damaging Het
Zfp987 T G 4: 146,061,505 (GRCm39) S312R probably benign Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123,143,658 (GRCm39) missense probably benign 0.00
IGL01621:Sec24d APN 3 123,087,807 (GRCm39) critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123,087,244 (GRCm39) nonsense probably null
IGL02064:Sec24d APN 3 123,137,463 (GRCm39) splice site probably benign
IGL02125:Sec24d APN 3 123,152,607 (GRCm39) missense probably damaging 1.00
IGL02173:Sec24d APN 3 123,147,330 (GRCm39) missense probably damaging 1.00
IGL03239:Sec24d APN 3 123,130,138 (GRCm39) missense probably benign 0.00
Scanty UTSW 3 123,148,596 (GRCm39) missense probably damaging 1.00
3-1:Sec24d UTSW 3 123,147,279 (GRCm39) missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123,136,827 (GRCm39) missense probably damaging 1.00
R0008:Sec24d UTSW 3 123,144,525 (GRCm39) splice site probably benign
R0838:Sec24d UTSW 3 123,099,485 (GRCm39) missense probably benign 0.08
R1775:Sec24d UTSW 3 123,130,166 (GRCm39) missense probably damaging 1.00
R1895:Sec24d UTSW 3 123,147,043 (GRCm39) missense probably benign 0.04
R1946:Sec24d UTSW 3 123,147,043 (GRCm39) missense probably benign 0.04
R2238:Sec24d UTSW 3 123,143,543 (GRCm39) splice site probably null
R2504:Sec24d UTSW 3 123,147,255 (GRCm39) missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123,144,395 (GRCm39) missense probably damaging 0.98
R2895:Sec24d UTSW 3 123,136,800 (GRCm39) missense probably damaging 1.00
R3428:Sec24d UTSW 3 123,137,572 (GRCm39) splice site probably benign
R4573:Sec24d UTSW 3 123,152,519 (GRCm39) missense probably damaging 1.00
R4668:Sec24d UTSW 3 123,149,423 (GRCm39) missense probably damaging 0.98
R4706:Sec24d UTSW 3 123,149,427 (GRCm39) missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123,148,596 (GRCm39) missense probably damaging 1.00
R4982:Sec24d UTSW 3 123,093,255 (GRCm39) missense probably benign 0.29
R5030:Sec24d UTSW 3 123,152,550 (GRCm39) missense probably damaging 0.98
R5041:Sec24d UTSW 3 123,087,880 (GRCm39) missense probably damaging 0.96
R5078:Sec24d UTSW 3 123,084,201 (GRCm39) missense probably benign 0.00
R5108:Sec24d UTSW 3 123,099,434 (GRCm39) splice site probably null
R5174:Sec24d UTSW 3 123,158,575 (GRCm39) missense probably damaging 0.99
R5661:Sec24d UTSW 3 123,136,791 (GRCm39) missense possibly damaging 0.95
R5661:Sec24d UTSW 3 123,136,734 (GRCm39) missense probably damaging 1.00
R5859:Sec24d UTSW 3 123,072,961 (GRCm39) unclassified probably benign
R5944:Sec24d UTSW 3 123,087,230 (GRCm39) missense probably benign 0.01
R6053:Sec24d UTSW 3 123,072,871 (GRCm39) nonsense probably null
R6515:Sec24d UTSW 3 123,136,719 (GRCm39) missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123,084,201 (GRCm39) missense probably benign 0.00
R6557:Sec24d UTSW 3 123,136,736 (GRCm39) missense probably damaging 1.00
R6593:Sec24d UTSW 3 123,147,061 (GRCm39) missense probably damaging 1.00
R6594:Sec24d UTSW 3 123,087,412 (GRCm39) missense probably damaging 1.00
R6842:Sec24d UTSW 3 123,136,868 (GRCm39) missense probably benign 0.00
R7072:Sec24d UTSW 3 123,124,000 (GRCm39) missense probably damaging 1.00
R7481:Sec24d UTSW 3 123,144,412 (GRCm39) missense probably damaging 1.00
R7554:Sec24d UTSW 3 123,149,423 (GRCm39) missense probably damaging 1.00
R8270:Sec24d UTSW 3 123,099,535 (GRCm39) missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123,147,073 (GRCm39) missense probably damaging 1.00
R8713:Sec24d UTSW 3 123,137,541 (GRCm39) missense probably damaging 1.00
R8872:Sec24d UTSW 3 123,148,585 (GRCm39) splice site probably benign
R8922:Sec24d UTSW 3 123,144,488 (GRCm39) missense probably damaging 1.00
R8974:Sec24d UTSW 3 123,099,498 (GRCm39) missense probably damaging 1.00
R9015:Sec24d UTSW 3 123,121,287 (GRCm39) missense probably benign 0.43
R9050:Sec24d UTSW 3 123,144,374 (GRCm39) missense probably benign 0.00
R9065:Sec24d UTSW 3 123,149,452 (GRCm39) missense probably damaging 1.00
R9128:Sec24d UTSW 3 123,087,810 (GRCm39) missense probably benign
R9447:Sec24d UTSW 3 123,084,162 (GRCm39) missense probably benign 0.00
R9701:Sec24d UTSW 3 123,063,321 (GRCm39) missense probably damaging 1.00
R9758:Sec24d UTSW 3 123,136,803 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACATGGGTTATTTTGAACTC -3'
(R):5'- TTTAACATGGCATGCCCGAG -3'

Sequencing Primer
(F):5'- ACCACACAGAGGACTTGT -3'
(R):5'- TAACATGGCATGCCCGAGTTATG -3'
Posted On 2016-12-15