Mutagenetix > Incidental Mutation

Incidental Mutation 'R5775:Sec24d'

448711

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

MMRRC Submission

043374-MU

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5775 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 123290460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 96 (A96V)

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

AlphaFold

Q6NXL1

Predicted Effect

probably benign
Transcript: ENSMUST00000047923
AA Change: A96V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: A96V

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197291

Meta Mutation Damage Score

0.0648

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6a	A	G	12: 113,546,266	D753G	possibly damaging	Het
AF067061	T	A	13: 120,263,939	C46*	probably null	Het
Arpc2	T	A	1: 74,255,949		probably null	Het
Atxn2	C	T	5: 121,813,449	T619M	probably damaging	Het
Cacna1s	T	C	1: 136,108,122	Y1120H	probably damaging	Het
Calm5	T	C	13: 3,854,435	L20S	probably damaging	Het
Carmil1	T	C	13: 24,276,537	I20V	probably benign	Het
Cd177	T	C	7: 24,752,268	E441G	probably damaging	Het
Cd63	T	A	10: 128,910,430	C9S	probably damaging	Het
Cep250	A	C	2: 155,969,374	D380A	possibly damaging	Het
Col5a3	G	T	9: 20,801,072	P509Q	unknown	Het
Cyp11b2	A	G	15: 74,853,478	V264A	probably benign	Het
Dennd6a	T	A	14: 26,619,373	L214*	probably null	Het
Dna2	A	G	10: 62,949,242	N46S	possibly damaging	Het
Elovl1	G	A	4: 118,430,897	V77I	probably benign	Het
Eml1	A	T	12: 108,506,554	Y207F	probably damaging	Het
Epha6	C	T	16: 59,818,994	R839Q	possibly damaging	Het
Erlec1	A	T	11: 30,943,848	S105T	probably benign	Het
Esp3	T	A	17: 40,633,577	S37T	possibly damaging	Het
Foxh1	G	A	15: 76,669,849	A8V	probably benign	Het
Fut1	A	C	7: 45,619,462	D280A	probably damaging	Het
Gm13998	G	T	2: 119,878,411		noncoding transcript	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
H2afz	T	C	3: 137,865,619	Y61H	probably damaging	Het
Kcns1	T	C	2: 164,164,766	I426V	probably damaging	Het
Kdm4c	T	G	4: 74,359,431	V774G	probably damaging	Het
Mrc2	G	A	11: 105,337,813	V673I	probably benign	Het
Mtnr1b	G	A	9: 15,862,872	A297V	possibly damaging	Het
Olfr1173	A	T	2: 88,274,701	M116K	probably damaging	Het
Olfr889	A	T	9: 38,116,127	E110D	probably damaging	Het
Osbpl5	A	T	7: 143,704,529	V346D	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Pigo	T	C	4: 43,023,475	D233G	probably damaging	Het
Pmm1	A	T	15: 81,951,955	I152N	probably benign	Het
Pot1a	A	T	6: 25,757,298		probably null	Het
Ppp1r12b	G	T	1: 134,876,042	L460I	probably benign	Het
Prrc2a	T	C	17: 35,158,487	D565G	unknown	Het
Psd	C	A	19: 46,314,772	E724*	probably null	Het
Rasa2	C	T	9: 96,577,468		probably null	Het
Rsbn1	A	T	3: 103,962,572	Q783L	possibly damaging	Het
Ryr2	T	C	13: 11,769,962	Y1035C	probably damaging	Het
Sec61a2	A	T	2: 5,882,774		probably null	Het
Sec62	A	G	3: 30,793,287		probably benign	Het
Tmem132b	T	A	5: 125,638,330		probably null	Het
Tnip3	A	G	6: 65,614,757	S247G	probably benign	Het
Traf3	A	G	12: 111,252,728	K263R	possibly damaging	Het
Tubgcp3	A	T	8: 12,625,056	I713N	probably damaging	Het
Unc5c	A	G	3: 141,828,520	E860G	probably damaging	Het
Usp44	A	G	10: 93,845,978	S97G	possibly damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps37a	A	G	8: 40,529,119	H109R	probably damaging	Het
Wfikkn2	G	T	11: 94,238,288	D342E	probably benign	Het
Zfp354b	A	T	11: 50,922,820	F426Y	probably benign	Het
Zfp462	C	A	4: 55,010,590	T852N	probably damaging	Het
Zfp987	T	G	4: 146,124,935	S312R	probably benign	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0008:Sec24d	UTSW	3	123350876	splice site	probably benign
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1775:Sec24d	UTSW	3	123336517	missense	probably damaging	1.00
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R1946:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2504:Sec24d	UTSW	3	123353606	missense	possibly damaging	0.69
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R4982:Sec24d	UTSW	3	123299606	missense	probably benign	0.29
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5078:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R5108:Sec24d	UTSW	3	123305785	splice site	probably null
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343085	missense	probably damaging	1.00
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00
R8270:Sec24d	UTSW	3	123305886	missense	possibly damaging	0.90
R8481:Sec24d	UTSW	3	123353424	missense	probably damaging	1.00
R8713:Sec24d	UTSW	3	123343892	missense	probably damaging	1.00
R8872:Sec24d	UTSW	3	123354936	splice site	probably benign
R8922:Sec24d	UTSW	3	123350839	missense	probably damaging	1.00
R8974:Sec24d	UTSW	3	123305849	missense	probably damaging	1.00
R9015:Sec24d	UTSW	3	123327638	missense	probably benign	0.43
R9050:Sec24d	UTSW	3	123350725	missense	probably benign	0.00
R9065:Sec24d	UTSW	3	123355803	missense	probably damaging	1.00
R9128:Sec24d	UTSW	3	123294161	missense	probably benign
R9447:Sec24d	UTSW	3	123290513	missense	probably benign	0.00
R9701:Sec24d	UTSW	3	123269672	missense	probably damaging	1.00
R9758:Sec24d	UTSW	3	123343154	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCACATGGGTTATTTTGAACTC -3'
(R):5'- TTTAACATGGCATGCCCGAG -3'

Sequencing Primer
(F):5'- ACCACACAGAGGACTTGT -3'
(R):5'- TAACATGGCATGCCCGAGTTATG -3'

Posted On

2016-12-15