Incidental Mutation 'R5775:H2afz'
ID448712
Institutional Source Beutler Lab
Gene Symbol H2afz
Ensembl Gene ENSMUSG00000037894
Gene NameH2A histone family, member Z
SynonymsH2A.Z
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location137864487-137866922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137865619 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 61 (Y61H)
Ref Sequence ENSEMBL: ENSMUSP00000133339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041045] [ENSMUST00000090178] [ENSMUST00000172696] [ENSMUST00000173790] [ENSMUST00000174561] [ENSMUST00000197711]
Predicted Effect probably damaging
Transcript: ENSMUST00000041045
AA Change: Y61H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036907
Gene: ENSMUSG00000037894
AA Change: Y61H

DomainStartEndE-ValueType
H2A 5 125 2.05e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090178
SMART Domains Protein: ENSMUSP00000087641
Gene: ENSMUSG00000074212

DomainStartEndE-ValueType
DnaJ 107 164 3.8e-28 SMART
low complexity region 226 242 N/A INTRINSIC
Pfam:DUF1977 265 371 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138010
Predicted Effect unknown
Transcript: ENSMUST00000172696
AA Change: V48A
SMART Domains Protein: ENSMUSP00000133541
Gene: ENSMUSG00000037894
AA Change: V48A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173666
Predicted Effect probably damaging
Transcript: ENSMUST00000173790
AA Change: Y61H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133339
Gene: ENSMUSG00000037894
AA Change: Y61H

DomainStartEndE-ValueType
H2A 5 85 2.61e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174561
AA Change: Y61H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134059
Gene: ENSMUSG00000037894
AA Change: Y61H

DomainStartEndE-ValueType
H2A 5 102 3.68e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197711
SMART Domains Protein: ENSMUSP00000143194
Gene: ENSMUSG00000074212

DomainStartEndE-ValueType
DnaJ 57 114 2.4e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198830
Meta Mutation Damage Score 0.9447 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent member of the histone H2A family that is distinct from other members of the family. Studies in mice have shown that this particular histone is required for embryonic development and indicate that lack of functional histone H2A leads to embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous disruption of this gene results in an abnormal inner cell mass and early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in H2afz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:H2afz APN 3 137865596 missense probably damaging 0.98
R1957:H2afz UTSW 3 137865514 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGCGCGCACATCTTATC -3'
(R):5'- GGCACGCAATTGCATTTGC -3'

Sequencing Primer
(F):5'- GGCGCGCACATCTTATCTTAACG -3'
(R):5'- AGGAGCAGCACACTCTGG -3'
Posted On2016-12-15