Mutagenetix > Incidental Mutation

Incidental Mutation 'R5775:Pot1a'

448723

Institutional Source

Beutler Lab

Gene Symbol

Pot1a

Ensembl Gene

ENSMUSG00000029676

Gene Name

protection of telomeres 1A

Synonyms

1500031H18Rik, Pot1

MMRRC Submission

043374-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5775 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25743737-25809246 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 25757298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115327] [ENSMUST00000115330] [ENSMUST00000115330] [ENSMUST00000115330] [ENSMUST00000166445] [ENSMUST00000166445] [ENSMUST00000166445]

AlphaFold

Q91WC1

Predicted Effect

probably benign
Transcript: ENSMUST00000115327

SMART Domains

Protein: ENSMUSP00000110982
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115329

SMART Domains

Protein: ENSMUSP00000110984
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115330

SMART Domains

Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
Pfam:POT1PC	152	299	6.7e-41	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115330

SMART Domains

Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
Pfam:POT1PC	152	299	6.7e-41	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115330

SMART Domains

Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
Pfam:POT1PC	152	299	6.7e-41	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000166445

SMART Domains

Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166445

SMART Domains

Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166445

SMART Domains

Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676

Domain	Start	End	E-Value	Type
Telo_bind	11	141	3.6e-53	SMART
low complexity region	253	260	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6a	A	G	12: 113,546,266	D753G	possibly damaging	Het
AF067061	T	A	13: 120,263,939	C46*	probably null	Het
Arpc2	T	A	1: 74,255,949		probably null	Het
Atxn2	C	T	5: 121,813,449	T619M	probably damaging	Het
Cacna1s	T	C	1: 136,108,122	Y1120H	probably damaging	Het
Calm5	T	C	13: 3,854,435	L20S	probably damaging	Het
Carmil1	T	C	13: 24,276,537	I20V	probably benign	Het
Cd177	T	C	7: 24,752,268	E441G	probably damaging	Het
Cd63	T	A	10: 128,910,430	C9S	probably damaging	Het
Cep250	A	C	2: 155,969,374	D380A	possibly damaging	Het
Col5a3	G	T	9: 20,801,072	P509Q	unknown	Het
Cyp11b2	A	G	15: 74,853,478	V264A	probably benign	Het
Dennd6a	T	A	14: 26,619,373	L214*	probably null	Het
Dna2	A	G	10: 62,949,242	N46S	possibly damaging	Het
Elovl1	G	A	4: 118,430,897	V77I	probably benign	Het
Eml1	A	T	12: 108,506,554	Y207F	probably damaging	Het
Epha6	C	T	16: 59,818,994	R839Q	possibly damaging	Het
Erlec1	A	T	11: 30,943,848	S105T	probably benign	Het
Esp3	T	A	17: 40,633,577	S37T	possibly damaging	Het
Foxh1	G	A	15: 76,669,849	A8V	probably benign	Het
Fut1	A	C	7: 45,619,462	D280A	probably damaging	Het
Gm13998	G	T	2: 119,878,411		noncoding transcript	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
H2afz	T	C	3: 137,865,619	Y61H	probably damaging	Het
Kcns1	T	C	2: 164,164,766	I426V	probably damaging	Het
Kdm4c	T	G	4: 74,359,431	V774G	probably damaging	Het
Mrc2	G	A	11: 105,337,813	V673I	probably benign	Het
Mtnr1b	G	A	9: 15,862,872	A297V	possibly damaging	Het
Olfr1173	A	T	2: 88,274,701	M116K	probably damaging	Het
Olfr889	A	T	9: 38,116,127	E110D	probably damaging	Het
Osbpl5	A	T	7: 143,704,529	V346D	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Pigo	T	C	4: 43,023,475	D233G	probably damaging	Het
Pmm1	A	T	15: 81,951,955	I152N	probably benign	Het
Ppp1r12b	G	T	1: 134,876,042	L460I	probably benign	Het
Prrc2a	T	C	17: 35,158,487	D565G	unknown	Het
Psd	C	A	19: 46,314,772	E724*	probably null	Het
Rasa2	C	T	9: 96,577,468		probably null	Het
Rsbn1	A	T	3: 103,962,572	Q783L	possibly damaging	Het
Ryr2	T	C	13: 11,769,962	Y1035C	probably damaging	Het
Sec24d	C	T	3: 123,290,460	A96V	probably benign	Het
Sec61a2	A	T	2: 5,882,774		probably null	Het
Sec62	A	G	3: 30,793,287		probably benign	Het
Tmem132b	T	A	5: 125,638,330		probably null	Het
Tnip3	A	G	6: 65,614,757	S247G	probably benign	Het
Traf3	A	G	12: 111,252,728	K263R	possibly damaging	Het
Tubgcp3	A	T	8: 12,625,056	I713N	probably damaging	Het
Unc5c	A	G	3: 141,828,520	E860G	probably damaging	Het
Usp44	A	G	10: 93,845,978	S97G	possibly damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps37a	A	G	8: 40,529,119	H109R	probably damaging	Het
Wfikkn2	G	T	11: 94,238,288	D342E	probably benign	Het
Zfp354b	A	T	11: 50,922,820	F426Y	probably benign	Het
Zfp462	C	A	4: 55,010,590	T852N	probably damaging	Het
Zfp987	T	G	4: 146,124,935	S312R	probably benign	Het

Other mutations in Pot1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00857:Pot1a	APN	6	25744628	missense	probably benign	0.01
IGL01393:Pot1a	APN	6	25744631	nonsense	probably null
IGL01411:Pot1a	APN	6	25750144	splice site	probably benign
IGL01774:Pot1a	APN	6	25753277	missense	probably benign	0.00
IGL01981:Pot1a	APN	6	25750100	missense	probably damaging	1.00
IGL02404:Pot1a	APN	6	25764432	splice site	probably benign
IGL02530:Pot1a	APN	6	25794593	missense	probably damaging	1.00
IGL02755:Pot1a	APN	6	25771613	missense	possibly damaging	0.81
IGL03127:Pot1a	APN	6	25794616	missense	probably benign	0.00
IGL03396:Pot1a	APN	6	25745914	missense	possibly damaging	0.93
BB001:Pot1a	UTSW	6	25753310	missense	possibly damaging	0.94
BB011:Pot1a	UTSW	6	25753310	missense	possibly damaging	0.94
R0329:Pot1a	UTSW	6	25778831	splice site	probably benign
R0359:Pot1a	UTSW	6	25771680	splice site	probably benign
R0530:Pot1a	UTSW	6	25771541	missense	possibly damaging	0.86
R0840:Pot1a	UTSW	6	25748284	splice site	probably benign
R0918:Pot1a	UTSW	6	25756268	missense	possibly damaging	0.92
R1650:Pot1a	UTSW	6	25745965	missense	probably damaging	1.00
R1937:Pot1a	UTSW	6	25753324	missense	probably benign	0.15
R2142:Pot1a	UTSW	6	25750044	splice site	probably null
R4072:Pot1a	UTSW	6	25752357	splice site	probably null
R4074:Pot1a	UTSW	6	25752357	splice site	probably null
R4322:Pot1a	UTSW	6	25745930	missense	probably benign	0.02
R4895:Pot1a	UTSW	6	25753206	missense	probably damaging	1.00
R4910:Pot1a	UTSW	6	25746021	intron	probably benign
R4933:Pot1a	UTSW	6	25771541	missense	possibly damaging	0.86
R5530:Pot1a	UTSW	6	25778894	missense	probably damaging	1.00
R5748:Pot1a	UTSW	6	25758856	missense	possibly damaging	0.77
R5870:Pot1a	UTSW	6	25778951	missense	possibly damaging	0.90
R6180:Pot1a	UTSW	6	25771621	missense	probably benign	0.00
R6377:Pot1a	UTSW	6	25778870	missense	probably benign	0.06
R7251:Pot1a	UTSW	6	25752498	splice site	probably null
R7457:Pot1a	UTSW	6	25771622	missense	probably benign	0.26
R7679:Pot1a	UTSW	6	25771634	missense	probably benign	0.16
R7717:Pot1a	UTSW	6	25758823	missense	probably benign	0.45
R7924:Pot1a	UTSW	6	25753310	missense	possibly damaging	0.94
R8078:Pot1a	UTSW	6	25750108	missense	probably benign	0.13
R8084:Pot1a	UTSW	6	25771536	missense	possibly damaging	0.81
R8170:Pot1a	UTSW	6	25758803	makesense	probably null
R9070:Pot1a	UTSW	6	25744630	missense
R9525:Pot1a	UTSW	6	25745917	missense	probably benign	0.06
R9574:Pot1a	UTSW	6	25775719	missense	possibly damaging	0.73
R9638:Pot1a	UTSW	6	25750107	nonsense	probably null
R9698:Pot1a	UTSW	6	25744616	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CATGCCTCATTTCACATTTGAGG -3'
(R):5'- GAAAGAAGACACCTTGCCTGTC -3'

Sequencing Primer
(F):5'- TTCACATTTGAGGTTACACACACAC -3'
(R):5'- GCCTGTCACATTTTTATAACTAAGCC -3'

Posted On

2016-12-15