Incidental Mutation 'R5775:Cd177'
ID448725
Institutional Source Beutler Lab
Gene Symbol Cd177
Ensembl Gene ENSMUSG00000052212
Gene NameCD177 antigen
SynonymsPdp3, 1190003K14Rik
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24743983-24760311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24752268 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 441 (E441G)
Ref Sequence ENSEMBL: ENSMUSP00000064934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063956]
Predicted Effect probably damaging
Transcript: ENSMUST00000063956
AA Change: E441G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: E441G

DomainStartEndE-ValueType
Pfam:UPAR_LY6 134 214 3.7e-11 PFAM
Pfam:UPAR_LY6 226 300 1.2e-4 PFAM
low complexity region 301 317 N/A INTRINSIC
Pfam:UPAR_LY6 322 400 1.5e-9 PFAM
Pfam:UPAR_LY6 511 586 9.1e-12 PFAM
Pfam:UPAR_LY6 705 782 1.4e-11 PFAM
low complexity region 795 811 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206160
Meta Mutation Damage Score 0.2843 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Cd177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cd177 APN 7 24759751 missense possibly damaging 0.59
IGL00479:Cd177 APN 7 24758015 missense probably benign 0.05
IGL00673:Cd177 APN 7 24752017 missense possibly damaging 0.78
IGL00913:Cd177 APN 7 24756195 missense probably damaging 1.00
IGL01445:Cd177 APN 7 24752071 missense possibly damaging 0.95
IGL02021:Cd177 APN 7 24745206 missense probably benign 0.16
IGL02134:Cd177 APN 7 24752352 missense probably benign 0.01
IGL02532:Cd177 APN 7 24745249 missense probably benign 0.30
IGL02821:Cd177 APN 7 24744393 missense probably damaging 1.00
IGL02821:Cd177 APN 7 24744394 missense probably damaging 1.00
IGL02888:Cd177 APN 7 24758437 missense probably damaging 0.99
R0506:Cd177 UTSW 7 24758356 missense probably damaging 1.00
R0601:Cd177 UTSW 7 24752313 missense probably benign 0.00
R0631:Cd177 UTSW 7 24756686 missense probably benign 0.03
R0713:Cd177 UTSW 7 24744430 missense probably benign 0.25
R1595:Cd177 UTSW 7 24744964 missense probably benign
R1659:Cd177 UTSW 7 24746137 missense probably damaging 1.00
R2258:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2260:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2379:Cd177 UTSW 7 24758043 missense possibly damaging 0.80
R2763:Cd177 UTSW 7 24758037 missense probably benign 0.05
R2929:Cd177 UTSW 7 24754279 nonsense probably null
R3815:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3818:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3919:Cd177 UTSW 7 24744433 missense probably benign 0.15
R4300:Cd177 UTSW 7 24750420 missense possibly damaging 0.48
R4494:Cd177 UTSW 7 24752003 missense probably benign 0.06
R4781:Cd177 UTSW 7 24750626 missense probably damaging 1.00
R4819:Cd177 UTSW 7 24752271 missense probably damaging 1.00
R5062:Cd177 UTSW 7 24744316 missense probably benign 0.03
R5186:Cd177 UTSW 7 24744923 missense probably benign 0.31
R5285:Cd177 UTSW 7 24746249 missense probably benign 0.00
R5415:Cd177 UTSW 7 24752391 missense probably damaging 1.00
R5577:Cd177 UTSW 7 24745137 missense probably damaging 1.00
R5637:Cd177 UTSW 7 24756323 missense probably benign 0.01
R5673:Cd177 UTSW 7 24750362 missense probably damaging 1.00
R5731:Cd177 UTSW 7 24744421 missense probably damaging 1.00
R5840:Cd177 UTSW 7 24758070 missense probably damaging 0.99
R5870:Cd177 UTSW 7 24756332 missense probably benign 0.00
R5872:Cd177 UTSW 7 24752263 missense probably null 1.00
R6148:Cd177 UTSW 7 24744273 nonsense probably null
R6505:Cd177 UTSW 7 24744246 missense probably benign 0.00
R6897:Cd177 UTSW 7 24745074 missense probably benign 0.31
R7023:Cd177 UTSW 7 24759762 missense probably benign 0.44
R7088:Cd177 UTSW 7 24745133 nonsense probably null
R7188:Cd177 UTSW 7 24756647 missense probably damaging 1.00
R7366:Cd177 UTSW 7 24756722 missense probably damaging 1.00
R7744:Cd177 UTSW 7 24750375 missense probably damaging 1.00
R8008:Cd177 UTSW 7 24752349 missense not run
R8029:Cd177 UTSW 7 24756169 nonsense probably null
R8030:Cd177 UTSW 7 24756169 nonsense probably null
R8032:Cd177 UTSW 7 24756169 nonsense probably null
Z1176:Cd177 UTSW 7 24746171 missense probably benign 0.01
Z1177:Cd177 UTSW 7 24760256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGGTCATTGCAGAAGTC -3'
(R):5'- GCTGCTGCCTGTGAATGAAG -3'

Sequencing Primer
(F):5'- TTTTACGGCACACTCGGG -3'
(R):5'- CCTGTGAATGAAGTCGCTTAC -3'
Posted On2016-12-15