Incidental Mutation 'R5775:Fut1'
ID448726
Institutional Source Beutler Lab
Gene Symbol Fut1
Ensembl Gene ENSMUSG00000008461
Gene Namefucosyltransferase 1
SynonymsH transferase
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45617289-45621059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45619462 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 280 (D280A)
Ref Sequence ENSEMBL: ENSMUSP00000008605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008605] [ENSMUST00000033099] [ENSMUST00000033100] [ENSMUST00000209379] [ENSMUST00000210150]
Predicted Effect probably damaging
Transcript: ENSMUST00000008605
AA Change: D280A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000008605
Gene: ENSMUSG00000008461
AA Change: D280A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Glyco_transf_11 39 355 3.1e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033099
SMART Domains Protein: ENSMUSP00000033099
Gene: ENSMUSG00000030827

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FGF 44 169 3.95e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033100
SMART Domains Protein: ENSMUSP00000033100
Gene: ENSMUSG00000064158

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
Pfam:IZUMO 21 166 2.6e-53 PFAM
IG 167 253 2.43e-2 SMART
transmembrane domain 320 342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209379
AA Change: D225A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209590
Predicted Effect probably benign
Transcript: ENSMUST00000210150
Meta Mutation Damage Score 0.7673 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous null mice are viable and healthy, lack alpha(1,2)fucose residues from the apical surface of pancreatic acinar glands and are deficient in epididymal cell surface alpha(1,2)fucosylated glycans but show normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Fut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Fut1 APN 7 45619431 missense probably damaging 1.00
IGL02015:Fut1 APN 7 45618975 missense probably damaging 0.98
IGL02232:Fut1 APN 7 45619447 missense probably damaging 1.00
IGL02934:Fut1 APN 7 45618703 missense possibly damaging 0.49
IGL02976:Fut1 APN 7 45619320 missense probably damaging 1.00
IGL03091:Fut1 APN 7 45619527 missense probably damaging 1.00
IGL03169:Fut1 APN 7 45619033 missense probably benign 0.05
R0107:Fut1 UTSW 7 45618846 missense possibly damaging 0.50
R0107:Fut1 UTSW 7 45618846 missense possibly damaging 0.50
R1413:Fut1 UTSW 7 45619428 missense probably damaging 0.98
R2039:Fut1 UTSW 7 45618991 missense possibly damaging 0.62
R2403:Fut1 UTSW 7 45619219 missense probably benign 0.14
R2516:Fut1 UTSW 7 45619198 missense probably benign 0.03
R3429:Fut1 UTSW 7 45619374 missense probably damaging 1.00
R3430:Fut1 UTSW 7 45619374 missense probably damaging 1.00
R6244:Fut1 UTSW 7 45619306 missense possibly damaging 0.79
R6961:Fut1 UTSW 7 45619539 missense probably damaging 0.99
R7052:Fut1 UTSW 7 45619757 makesense probably null
R8027:Fut1 UTSW 7 45618865 missense probably damaging 1.00
Z1177:Fut1 UTSW 7 45619229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACTATCTGGAGGTGATGCC -3'
(R):5'- GGGGACAAGTCTGCATTGATG -3'

Sequencing Primer
(F):5'- ACTATCTGGAGGTGATGCCCAATC -3'
(R):5'- GATCTTCAGAAACTCCGAATCTGG -3'
Posted On2016-12-15