Incidental Mutation 'R5775:Mtnr1b'
ID448731
Institutional Source Beutler Lab
Gene Symbol Mtnr1b
Ensembl Gene ENSMUSG00000050901
Gene Namemelatonin receptor 1B
SynonymsMt2, Mel1b
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15824528-15874556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 15862872 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 297 (A297V)
Ref Sequence ENSEMBL: ENSMUSP00000138524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057920] [ENSMUST00000182947]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057920
AA Change: A297V

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053086
Gene: ENSMUSG00000050901
AA Change: A297V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 254 3.7e-11 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.6e-12 PFAM
Pfam:7tm_1 57 308 3.4e-47 PFAM
Pfam:7TM_GPCR_Srv 59 317 1.1e-7 PFAM
low complexity region 348 359 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182947
AA Change: A297V

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138524
Gene: ENSMUSG00000050901
AA Change: A297V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 264 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.6e-12 PFAM
Pfam:7tm_1 57 308 1.4e-50 PFAM
Pfam:7TM_GPCR_Srv 59 319 7.5e-8 PFAM
low complexity region 348 359 N/A INTRINSIC
Meta Mutation Damage Score 0.2841 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This gene product is an integral membrane protein that is a G-protein coupled, 7-transmembrane receptor. It is found primarily in the retina and brain although this detection requires RT-PCR. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no obvious circadian phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Mtnr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Mtnr1b APN 9 15863200 missense probably damaging 1.00
IGL02041:Mtnr1b APN 9 15863293 missense probably benign 0.01
IGL02054:Mtnr1b APN 9 15874240 missense possibly damaging 0.93
IGL02147:Mtnr1b APN 9 15863376 missense probably damaging 0.96
IGL02620:Mtnr1b APN 9 15874321 missense possibly damaging 0.47
IGL03046:Mtnr1b UTSW 9 15862763 missense probably benign 0.00
R0362:Mtnr1b UTSW 9 15874304 missense probably damaging 1.00
R0784:Mtnr1b UTSW 9 15862785 missense probably benign 0.17
R1323:Mtnr1b UTSW 9 15863136 missense probably damaging 1.00
R1323:Mtnr1b UTSW 9 15863136 missense probably damaging 1.00
R1572:Mtnr1b UTSW 9 15863142 missense probably damaging 0.99
R1600:Mtnr1b UTSW 9 15863319 missense probably damaging 0.99
R2880:Mtnr1b UTSW 9 15862806 missense probably damaging 1.00
R2932:Mtnr1b UTSW 9 15874324 missense probably damaging 0.97
R4033:Mtnr1b UTSW 9 15863534 missense probably damaging 1.00
R5532:Mtnr1b UTSW 9 15862914 missense probably benign
R5765:Mtnr1b UTSW 9 15863163 missense probably damaging 1.00
R5893:Mtnr1b UTSW 9 15863244 missense probably damaging 0.98
R6025:Mtnr1b UTSW 9 15862797 missense probably damaging 1.00
R6247:Mtnr1b UTSW 9 15862786 missense probably benign
R6349:Mtnr1b UTSW 9 15863213 nonsense probably null
R6364:Mtnr1b UTSW 9 15863004 missense possibly damaging 0.63
R7485:Mtnr1b UTSW 9 15863294 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACAGGTTTGCTGCTAGG -3'
(R):5'- CTGAGACCGAGTGATTTGCG -3'

Sequencing Primer
(F):5'- TAGAGAGCACCTTCCTTGACAGG -3'
(R):5'- GAGTGATTTGCGCAGTTTCCTAACC -3'
Posted On2016-12-15