Mutagenetix > Incidental Mutations

Incidental Mutation 'R5775:Mrc2'

448741

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

043374-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5775 (G1)

Quality Score

191

Status

Validated

Chromosome

Chromosomal Location

105292643-105351139 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105337813 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 673 (V673I)

Ref Sequence

ENSEMBL: ENSMUSP00000097909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]

Predicted Effect

probably benign
Transcript: ENSMUST00000021038
AA Change: V673I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: V673I

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100335
AA Change: V673I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: V673I

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151135

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6a	A	G	12: 113,546,266	D753G	possibly damaging	Het
AF067061	T	A	13: 120,263,939	C46*	probably null	Het
Arpc2	T	A	1: 74,255,949		probably null	Het
Atxn2	C	T	5: 121,813,449	T619M	probably damaging	Het
Cacna1s	T	C	1: 136,108,122	Y1120H	probably damaging	Het
Calm5	T	C	13: 3,854,435	L20S	probably damaging	Het
Carmil1	T	C	13: 24,276,537	I20V	probably benign	Het
Cd177	T	C	7: 24,752,268	E441G	probably damaging	Het
Cd63	T	A	10: 128,910,430	C9S	probably damaging	Het
Cep250	A	C	2: 155,969,374	D380A	possibly damaging	Het
Col5a3	G	T	9: 20,801,072	P509Q	unknown	Het
Cyp11b2	A	G	15: 74,853,478	V264A	probably benign	Het
Dennd6a	T	A	14: 26,619,373	L214*	probably null	Het
Dna2	A	G	10: 62,949,242	N46S	possibly damaging	Het
Elovl1	G	A	4: 118,430,897	V77I	probably benign	Het
Eml1	A	T	12: 108,506,554	Y207F	probably damaging	Het
Epha6	C	T	16: 59,818,994	R839Q	possibly damaging	Het
Erlec1	A	T	11: 30,943,848	S105T	probably benign	Het
Esp3	T	A	17: 40,633,577	S37T	possibly damaging	Het
Foxh1	G	A	15: 76,669,849	A8V	probably benign	Het
Fut1	A	C	7: 45,619,462	D280A	probably damaging	Het
Gm13998	G	T	2: 119,878,411		noncoding transcript	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
H2afz	T	C	3: 137,865,619	Y61H	probably damaging	Het
Kcns1	T	C	2: 164,164,766	I426V	probably damaging	Het
Kdm4c	T	G	4: 74,359,431	V774G	probably damaging	Het
Mtnr1b	G	A	9: 15,862,872	A297V	possibly damaging	Het
Olfr1173	A	T	2: 88,274,701	M116K	probably damaging	Het
Olfr889	A	T	9: 38,116,127	E110D	probably damaging	Het
Osbpl5	A	T	7: 143,704,529	V346D	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Pigo	T	C	4: 43,023,475	D233G	probably damaging	Het
Pmm1	A	T	15: 81,951,955	I152N	probably benign	Het
Pot1a	A	T	6: 25,757,298		probably null	Het
Ppp1r12b	G	T	1: 134,876,042	L460I	probably benign	Het
Prrc2a	T	C	17: 35,158,487	D565G	unknown	Het
Psd	C	A	19: 46,314,772	E724*	probably null	Het
Rasa2	C	T	9: 96,577,468		probably null	Het
Rsbn1	A	T	3: 103,962,572	Q783L	possibly damaging	Het
Ryr2	T	C	13: 11,769,962	Y1035C	probably damaging	Het
Sec24d	C	T	3: 123,290,460	A96V	probably benign	Het
Sec61a2	A	T	2: 5,882,774		probably null	Het
Sec62	A	G	3: 30,793,287		probably benign	Het
Tmem132b	T	A	5: 125,638,330		probably null	Het
Tnip3	A	G	6: 65,614,757	S247G	probably benign	Het
Traf3	A	G	12: 111,252,728	K263R	possibly damaging	Het
Tubgcp3	A	T	8: 12,625,056	I713N	probably damaging	Het
Unc5c	A	G	3: 141,828,520	E860G	probably damaging	Het
Usp44	A	G	10: 93,845,978	S97G	possibly damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps37a	A	G	8: 40,529,119	H109R	probably damaging	Het
Wfikkn2	G	T	11: 94,238,288	D342E	probably benign	Het
Zfp354b	A	T	11: 50,922,820	F426Y	probably benign	Het
Zfp462	C	A	4: 55,010,590	T852N	probably damaging	Het
Zfp987	T	G	4: 146,124,935	S312R	probably benign	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105328741	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105347643	nonsense	probably null
IGL01751:Mrc2	APN	11	105325734	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105336677	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105336707	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105333620	splice site	probably benign
IGL02940:Mrc2	APN	11	105341171	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105325571	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105347866	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105347692	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105340821	missense	probably benign
R1233:Mrc2	UTSW	11	105348415	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105348431	splice site	probably null
R1458:Mrc2	UTSW	11	105337772	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105347725	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105336656	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105338793	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105337720	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105347856	splice site	probably null
R2165:Mrc2	UTSW	11	105348431	splice site	probably null
R2265:Mrc2	UTSW	11	105348431	splice site	probably null
R2266:Mrc2	UTSW	11	105348431	splice site	probably null
R2267:Mrc2	UTSW	11	105348431	splice site	probably null
R2268:Mrc2	UTSW	11	105348431	splice site	probably null
R2269:Mrc2	UTSW	11	105348431	splice site	probably null
R2270:Mrc2	UTSW	11	105348431	splice site	probably null
R2271:Mrc2	UTSW	11	105348431	splice site	probably null
R2272:Mrc2	UTSW	11	105348431	splice site	probably null
R2296:Mrc2	UTSW	11	105348431	splice site	probably null
R2298:Mrc2	UTSW	11	105348431	splice site	probably null
R2300:Mrc2	UTSW	11	105348431	splice site	probably null
R2326:Mrc2	UTSW	11	105348431	splice site	probably null
R2518:Mrc2	UTSW	11	105348431	splice site	probably null
R2519:Mrc2	UTSW	11	105348431	splice site	probably null
R2520:Mrc2	UTSW	11	105348431	splice site	probably null
R2895:Mrc2	UTSW	11	105348431	splice site	probably null
R3029:Mrc2	UTSW	11	105348431	splice site	probably null
R3030:Mrc2	UTSW	11	105348431	splice site	probably null
R3079:Mrc2	UTSW	11	105336713	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105348431	splice site	probably null
R3149:Mrc2	UTSW	11	105348431	splice site	probably null
R3150:Mrc2	UTSW	11	105348431	splice site	probably null
R3420:Mrc2	UTSW	11	105348431	splice site	probably null
R3422:Mrc2	UTSW	11	105348431	splice site	probably null
R3441:Mrc2	UTSW	11	105347716	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105348431	splice site	probably null
R3731:Mrc2	UTSW	11	105348431	splice site	probably null
R3800:Mrc2	UTSW	11	105348431	splice site	probably null
R3820:Mrc2	UTSW	11	105348431	splice site	probably null
R3821:Mrc2	UTSW	11	105348431	splice site	probably null
R3837:Mrc2	UTSW	11	105348431	splice site	probably null
R3838:Mrc2	UTSW	11	105348431	splice site	probably null
R3849:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105347232	splice site	probably benign
R3932:Mrc2	UTSW	11	105348431	splice site	probably null
R3933:Mrc2	UTSW	11	105348431	splice site	probably null
R3971:Mrc2	UTSW	11	105328031	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105348431	splice site	probably null
R4107:Mrc2	UTSW	11	105348431	splice site	probably null
R4113:Mrc2	UTSW	11	105348431	splice site	probably null
R4274:Mrc2	UTSW	11	105348431	splice site	probably null
R4399:Mrc2	UTSW	11	105336658	nonsense	probably null
R4477:Mrc2	UTSW	11	105348431	splice site	probably null
R4478:Mrc2	UTSW	11	105348431	splice site	probably null
R4493:Mrc2	UTSW	11	105348431	splice site	probably null
R4494:Mrc2	UTSW	11	105348431	splice site	probably null
R4495:Mrc2	UTSW	11	105348431	splice site	probably null
R4547:Mrc2	UTSW	11	105336641	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105348431	splice site	probably null
R4601:Mrc2	UTSW	11	105348431	splice site	probably null
R4602:Mrc2	UTSW	11	105348431	splice site	probably null
R4603:Mrc2	UTSW	11	105348431	splice site	probably null
R4610:Mrc2	UTSW	11	105348431	splice site	probably null
R4611:Mrc2	UTSW	11	105348431	splice site	probably null
R4637:Mrc2	UTSW	11	105348431	splice site	probably null
R4672:Mrc2	UTSW	11	105343097	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105348431	splice site	probably null
R4675:Mrc2	UTSW	11	105348431	splice site	probably null
R4693:Mrc2	UTSW	11	105343702	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105348431	splice site	probably null
R4707:Mrc2	UTSW	11	105348431	splice site	probably null
R4791:Mrc2	UTSW	11	105348431	splice site	probably null
R4792:Mrc2	UTSW	11	105348431	splice site	probably null
R4888:Mrc2	UTSW	11	105341208	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105343582	missense	probably benign
R5600:Mrc2	UTSW	11	105333666	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105336214	nonsense	probably null
R5692:Mrc2	UTSW	11	105336642	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105332343	missense	probably damaging	1.00
R6140:Mrc2	UTSW	11	105346789	missense	probably benign
R6146:Mrc2	UTSW	11	105325644	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105346820	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105349843	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105349882	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105343080	splice site	probably null
R6680:Mrc2	UTSW	11	105325753	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105328418	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105348635	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105332236	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105325803	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105329235	missense	possibly damaging	0.92
R7537:Mrc2	UTSW	11	105292797	missense	probably benign
R7640:Mrc2	UTSW	11	105332295	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105346459	missense	probably benign	0.10
T0970:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105347475	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTGTCCCTGTAGAGACAAG -3'
(R):5'- CAGGCAAATTCTTCATCGGC -3'

Sequencing Primer
(F):5'- TCCTTCTCAGGGTACAGACGTG -3'
(R):5'- ATCGGCAATTACTCTGGTCTG -3'

Posted On

2016-12-15