Mutagenetix > Incidental Mutations

Incidental Mutation 'R5775:Eml1'

448742

Institutional Source

Beutler Lab

Gene Symbol

Eml1

Ensembl Gene

ENSMUSG00000058070

Gene Name

echinoderm microtubule associated protein like 1

Synonyms

A930030P13Rik, ELP79, 1110008N23Rik

MMRRC Submission

043374-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R5775 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108370957-108539617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108506554 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 207 (Y207F)

Ref Sequence

ENSEMBL: ENSMUSP00000118325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054955] [ENSMUST00000109857] [ENSMUST00000109860] [ENSMUST00000130999]

Predicted Effect

probably damaging
Transcript: ENSMUST00000054955
AA Change: Y176F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057209
Gene: ENSMUSG00000058070
AA Change: Y176F

Domain	Start	End	E-Value	Type
coiled coil region	1	41	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	119	146	N/A	INTRINSIC
WD40	228	277	5.6e-3	SMART
WD40	280	325	2.21e1	SMART
WD40	328	367	4.46e-1	SMART
WD40	375	413	5.73e0	SMART
WD40	416	456	5.75e-1	SMART
WD40	496	539	4.24e-3	SMART
WD40	542	580	1.37e2	SMART
WD40	583	622	1.7e-2	SMART
WD40	629	668	1.58e-2	SMART
Blast:WD40	694	735	7e-20	BLAST
WD40	741	781	2.96e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109857
AA Change: Y193F

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105483
Gene: ENSMUSG00000058070
AA Change: Y193F

Domain	Start	End	E-Value	Type
coiled coil region	1	41	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	119	146	N/A	INTRINSIC
WD40	245	294	5.6e-3	SMART
WD40	297	342	2.21e1	SMART
WD40	345	384	4.46e-1	SMART
WD40	392	430	5.73e0	SMART
WD40	433	473	5.75e-1	SMART
WD40	513	556	4.24e-3	SMART
WD40	559	597	1.37e2	SMART
WD40	600	639	1.7e-2	SMART
WD40	646	685	1.58e-2	SMART
Blast:WD40	711	752	7e-20	BLAST
WD40	758	798	2.96e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109860
AA Change: Y207F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105486
Gene: ENSMUSG00000058070
AA Change: Y207F

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
coiled coil region	31	72	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	150	177	N/A	INTRINSIC
Pfam:HELP	184	258	1.8e-35	PFAM
WD40	259	308	5.6e-3	SMART
WD40	311	356	2.21e1	SMART
WD40	359	398	4.46e-1	SMART
WD40	406	444	5.73e0	SMART
WD40	447	487	5.75e-1	SMART
WD40	527	570	4.24e-3	SMART
WD40	573	611	1.37e2	SMART
WD40	614	653	1.7e-2	SMART
WD40	660	699	1.58e-2	SMART
Blast:WD40	725	766	7e-20	BLAST
WD40	772	812	2.96e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130999
AA Change: Y207F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118325
Gene: ENSMUSG00000058070
AA Change: Y207F

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
coiled coil region	31	72	N/A	INTRINSIC
low complexity region	103	115	N/A	INTRINSIC
low complexity region	150	177	N/A	INTRINSIC
WD40	259	308	5.6e-3	SMART
WD40	311	356	2.21e1	SMART
WD40	359	398	4.46e-1	SMART
WD40	406	444	5.73e0	SMART
WD40	447	487	5.75e-1	SMART
WD40	527	570	4.24e-3	SMART
WD40	573	611	1.37e2	SMART
WD40	614	653	1.7e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138456

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155544

Meta Mutation Damage Score

0.1881

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit subcortical band heterotopia associated with seizures, developmental delay and behavioral deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6a	A	G	12: 113,546,266	D753G	possibly damaging	Het
AF067061	T	A	13: 120,263,939	C46*	probably null	Het
Arpc2	T	A	1: 74,255,949		probably null	Het
Atxn2	C	T	5: 121,813,449	T619M	probably damaging	Het
Cacna1s	T	C	1: 136,108,122	Y1120H	probably damaging	Het
Calm5	T	C	13: 3,854,435	L20S	probably damaging	Het
Carmil1	T	C	13: 24,276,537	I20V	probably benign	Het
Cd177	T	C	7: 24,752,268	E441G	probably damaging	Het
Cd63	T	A	10: 128,910,430	C9S	probably damaging	Het
Cep250	A	C	2: 155,969,374	D380A	possibly damaging	Het
Col5a3	G	T	9: 20,801,072	P509Q	unknown	Het
Cyp11b2	A	G	15: 74,853,478	V264A	probably benign	Het
Dennd6a	T	A	14: 26,619,373	L214*	probably null	Het
Dna2	A	G	10: 62,949,242	N46S	possibly damaging	Het
Elovl1	G	A	4: 118,430,897	V77I	probably benign	Het
Epha6	C	T	16: 59,818,994	R839Q	possibly damaging	Het
Erlec1	A	T	11: 30,943,848	S105T	probably benign	Het
Esp3	T	A	17: 40,633,577	S37T	possibly damaging	Het
Foxh1	G	A	15: 76,669,849	A8V	probably benign	Het
Fut1	A	C	7: 45,619,462	D280A	probably damaging	Het
Gm13998	G	T	2: 119,878,411		noncoding transcript	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
H2afz	T	C	3: 137,865,619	Y61H	probably damaging	Het
Kcns1	T	C	2: 164,164,766	I426V	probably damaging	Het
Kdm4c	T	G	4: 74,359,431	V774G	probably damaging	Het
Mrc2	G	A	11: 105,337,813	V673I	probably benign	Het
Mtnr1b	G	A	9: 15,862,872	A297V	possibly damaging	Het
Olfr1173	A	T	2: 88,274,701	M116K	probably damaging	Het
Olfr889	A	T	9: 38,116,127	E110D	probably damaging	Het
Osbpl5	A	T	7: 143,704,529	V346D	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Pigo	T	C	4: 43,023,475	D233G	probably damaging	Het
Pmm1	A	T	15: 81,951,955	I152N	probably benign	Het
Pot1a	A	T	6: 25,757,298		probably null	Het
Ppp1r12b	G	T	1: 134,876,042	L460I	probably benign	Het
Prrc2a	T	C	17: 35,158,487	D565G	unknown	Het
Psd	C	A	19: 46,314,772	E724*	probably null	Het
Rasa2	C	T	9: 96,577,468		probably null	Het
Rsbn1	A	T	3: 103,962,572	Q783L	possibly damaging	Het
Ryr2	T	C	13: 11,769,962	Y1035C	probably damaging	Het
Sec24d	C	T	3: 123,290,460	A96V	probably benign	Het
Sec61a2	A	T	2: 5,882,774		probably null	Het
Sec62	A	G	3: 30,793,287		probably benign	Het
Tmem132b	T	A	5: 125,638,330		probably null	Het
Tnip3	A	G	6: 65,614,757	S247G	probably benign	Het
Traf3	A	G	12: 111,252,728	K263R	possibly damaging	Het
Tubgcp3	A	T	8: 12,625,056	I713N	probably damaging	Het
Unc5c	A	G	3: 141,828,520	E860G	probably damaging	Het
Usp44	A	G	10: 93,845,978	S97G	possibly damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps37a	A	G	8: 40,529,119	H109R	probably damaging	Het
Wfikkn2	G	T	11: 94,238,288	D342E	probably benign	Het
Zfp354b	A	T	11: 50,922,820	F426Y	probably benign	Het
Zfp462	C	A	4: 55,010,590	T852N	probably damaging	Het
Zfp987	T	G	4: 146,124,935	S312R	probably benign	Het

Other mutations in Eml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:Eml1	APN	12	108514515	splice site	probably null
IGL00774:Eml1	APN	12	108514515	splice site	probably null
IGL01358:Eml1	APN	12	108514468	missense	probably benign	0.05
IGL02316:Eml1	APN	12	108534759	intron	probably benign
IGL02346:Eml1	APN	12	108537441	missense	possibly damaging	0.87
IGL02480:Eml1	APN	12	108521696	missense	probably benign	0.32
IGL02513:Eml1	APN	12	108530312	missense	probably damaging	1.00
IGL02556:Eml1	APN	12	108537366	missense	probably benign	0.00
IGL02565:Eml1	APN	12	108506520	missense	probably damaging	1.00
IGL03217:Eml1	APN	12	108534942	missense	probably benign	0.31
bubble	UTSW	12	108513071	critical splice donor site	probably null
R0027:Eml1	UTSW	12	108536298	missense	possibly damaging	0.90
R0067:Eml1	UTSW	12	108463527	missense	possibly damaging	0.61
R0124:Eml1	UTSW	12	108506608	missense	probably benign	0.00
R0124:Eml1	UTSW	12	108509178	missense	probably damaging	1.00
R0730:Eml1	UTSW	12	108530326	missense	possibly damaging	0.79
R1566:Eml1	UTSW	12	108471892	missense	probably damaging	0.99
R1883:Eml1	UTSW	12	108463652	missense	probably damaging	0.97
R1927:Eml1	UTSW	12	108538217	nonsense	probably null
R1938:Eml1	UTSW	12	108521396	missense	possibly damaging	0.75
R2070:Eml1	UTSW	12	108512999	missense	probably damaging	1.00
R2311:Eml1	UTSW	12	108537416	missense	probably damaging	0.99
R2417:Eml1	UTSW	12	108536275	missense	probably benign	0.00
R3120:Eml1	UTSW	12	108513053	missense	probably benign	0.31
R4352:Eml1	UTSW	12	108534837	intron	probably benign
R4471:Eml1	UTSW	12	108506635	intron	probably benign
R4655:Eml1	UTSW	12	108534713	missense	probably damaging	1.00
R5077:Eml1	UTSW	12	108506612	splice site	probably benign
R5094:Eml1	UTSW	12	108536311	missense	probably benign	0.11
R5113:Eml1	UTSW	12	108537337	missense	possibly damaging	0.74
R5524:Eml1	UTSW	12	108521376	missense	probably damaging	0.99
R6120:Eml1	UTSW	12	108527724	missense	probably damaging	1.00
R6224:Eml1	UTSW	12	108514508	missense	probably damaging	1.00
R6491:Eml1	UTSW	12	108513071	critical splice donor site	probably null
R7035:Eml1	UTSW	12	108509234	missense	probably damaging	1.00
R7134:Eml1	UTSW	12	108506551	missense	probably benign	0.00
R7273:Eml1	UTSW	12	108538173	missense	possibly damaging	0.87
R7606:Eml1	UTSW	12	108537366	missense	probably benign	0.45
R7744:Eml1	UTSW	12	108516604	missense	probably benign
R7820:Eml1	UTSW	12	108515174	missense	possibly damaging	0.81
R8013:Eml1	UTSW	12	108521679	missense	probably benign	0.18
Z1088:Eml1	UTSW	12	108537459	missense	possibly damaging	0.80
Z1177:Eml1	UTSW	12	108423139	start gained	probably benign
Z1177:Eml1	UTSW	12	108534656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGTACCAATCAACACGTTAG -3'
(R):5'- CTCCTACATGGCCACATCTG -3'

Sequencing Primer
(F):5'- TGCACAAGGGAGACGGCC -3'
(R):5'- CCTACATGGCCACATCTGAAATTTTG -3'

Posted On

2016-12-15