Incidental Mutation 'R5775:Eml1'
ID448742
Institutional Source Beutler Lab
Gene Symbol Eml1
Ensembl Gene ENSMUSG00000058070
Gene Nameechinoderm microtubule associated protein like 1
SynonymsA930030P13Rik, ELP79, 1110008N23Rik
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location108370957-108539617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108506554 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 207 (Y207F)
Ref Sequence ENSEMBL: ENSMUSP00000118325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054955] [ENSMUST00000109857] [ENSMUST00000109860] [ENSMUST00000130999]
Predicted Effect probably damaging
Transcript: ENSMUST00000054955
AA Change: Y176F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057209
Gene: ENSMUSG00000058070
AA Change: Y176F

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 228 277 5.6e-3 SMART
WD40 280 325 2.21e1 SMART
WD40 328 367 4.46e-1 SMART
WD40 375 413 5.73e0 SMART
WD40 416 456 5.75e-1 SMART
WD40 496 539 4.24e-3 SMART
WD40 542 580 1.37e2 SMART
WD40 583 622 1.7e-2 SMART
WD40 629 668 1.58e-2 SMART
Blast:WD40 694 735 7e-20 BLAST
WD40 741 781 2.96e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109857
AA Change: Y193F

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105483
Gene: ENSMUSG00000058070
AA Change: Y193F

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 245 294 5.6e-3 SMART
WD40 297 342 2.21e1 SMART
WD40 345 384 4.46e-1 SMART
WD40 392 430 5.73e0 SMART
WD40 433 473 5.75e-1 SMART
WD40 513 556 4.24e-3 SMART
WD40 559 597 1.37e2 SMART
WD40 600 639 1.7e-2 SMART
WD40 646 685 1.58e-2 SMART
Blast:WD40 711 752 7e-20 BLAST
WD40 758 798 2.96e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109860
AA Change: Y207F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105486
Gene: ENSMUSG00000058070
AA Change: Y207F

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
Pfam:HELP 184 258 1.8e-35 PFAM
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
WD40 660 699 1.58e-2 SMART
Blast:WD40 725 766 7e-20 BLAST
WD40 772 812 2.96e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130999
AA Change: Y207F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118325
Gene: ENSMUSG00000058070
AA Change: Y207F

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155544
Meta Mutation Damage Score 0.1881 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit subcortical band heterotopia associated with seizures, developmental delay and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Eml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Eml1 APN 12 108514515 splice site probably null
IGL00774:Eml1 APN 12 108514515 splice site probably null
IGL01358:Eml1 APN 12 108514468 missense probably benign 0.05
IGL02316:Eml1 APN 12 108534759 intron probably benign
IGL02346:Eml1 APN 12 108537441 missense possibly damaging 0.87
IGL02480:Eml1 APN 12 108521696 missense probably benign 0.32
IGL02513:Eml1 APN 12 108530312 missense probably damaging 1.00
IGL02556:Eml1 APN 12 108537366 missense probably benign 0.00
IGL02565:Eml1 APN 12 108506520 missense probably damaging 1.00
IGL03217:Eml1 APN 12 108534942 missense probably benign 0.31
bubble UTSW 12 108513071 critical splice donor site probably null
R0027:Eml1 UTSW 12 108536298 missense possibly damaging 0.90
R0067:Eml1 UTSW 12 108463527 missense possibly damaging 0.61
R0124:Eml1 UTSW 12 108506608 missense probably benign 0.00
R0124:Eml1 UTSW 12 108509178 missense probably damaging 1.00
R0730:Eml1 UTSW 12 108530326 missense possibly damaging 0.79
R1566:Eml1 UTSW 12 108471892 missense probably damaging 0.99
R1883:Eml1 UTSW 12 108463652 missense probably damaging 0.97
R1927:Eml1 UTSW 12 108538217 nonsense probably null
R1938:Eml1 UTSW 12 108521396 missense possibly damaging 0.75
R2070:Eml1 UTSW 12 108512999 missense probably damaging 1.00
R2311:Eml1 UTSW 12 108537416 missense probably damaging 0.99
R2417:Eml1 UTSW 12 108536275 missense probably benign 0.00
R3120:Eml1 UTSW 12 108513053 missense probably benign 0.31
R4352:Eml1 UTSW 12 108534837 intron probably benign
R4471:Eml1 UTSW 12 108506635 intron probably benign
R4655:Eml1 UTSW 12 108534713 missense probably damaging 1.00
R5077:Eml1 UTSW 12 108506612 splice site probably benign
R5094:Eml1 UTSW 12 108536311 missense probably benign 0.11
R5113:Eml1 UTSW 12 108537337 missense possibly damaging 0.74
R5524:Eml1 UTSW 12 108521376 missense probably damaging 0.99
R6120:Eml1 UTSW 12 108527724 missense probably damaging 1.00
R6224:Eml1 UTSW 12 108514508 missense probably damaging 1.00
R6491:Eml1 UTSW 12 108513071 critical splice donor site probably null
R7035:Eml1 UTSW 12 108509234 missense probably damaging 1.00
R7134:Eml1 UTSW 12 108506551 missense probably benign 0.00
R7273:Eml1 UTSW 12 108538173 missense possibly damaging 0.87
R7606:Eml1 UTSW 12 108537366 missense probably benign 0.45
R7744:Eml1 UTSW 12 108516604 missense probably benign
R7820:Eml1 UTSW 12 108515174 missense possibly damaging 0.81
R8013:Eml1 UTSW 12 108521679 missense probably benign 0.18
Z1088:Eml1 UTSW 12 108537459 missense possibly damaging 0.80
Z1177:Eml1 UTSW 12 108423139 start gained probably benign
Z1177:Eml1 UTSW 12 108534656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTACCAATCAACACGTTAG -3'
(R):5'- CTCCTACATGGCCACATCTG -3'

Sequencing Primer
(F):5'- TGCACAAGGGAGACGGCC -3'
(R):5'- CCTACATGGCCACATCTGAAATTTTG -3'
Posted On2016-12-15