Incidental Mutation 'R5775:Calm5'
ID448745
Institutional Source Beutler Lab
Gene Symbol Calm5
Ensembl Gene ENSMUSG00000099269
Gene Namecalmodulin 5
SynonymsScarf2
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3854173-3854761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3854435 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 20 (L20S)
Ref Sequence ENSEMBL: ENSMUSP00000139172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000183198] [ENSMUST00000184271]
Predicted Effect probably damaging
Transcript: ENSMUST00000183198
AA Change: L20S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139172
Gene: ENSMUSG00000099269
AA Change: L20S

DomainStartEndE-ValueType
EFh 12 40 1.9e-7 SMART
EFh 45 73 6.7e-10 SMART
EFh 81 109 1.5e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184271
AA Change: L43S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139342
Gene: ENSMUSG00000099269
AA Change: L43S

DomainStartEndE-ValueType
EFh 35 63 3.7e-5 SMART
EFh 68 96 1.35e-7 SMART
EFh 104 132 3.12e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192737
AA Change: W88R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202762
AA Change: W88R
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Calm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3732:Calm5 UTSW 13 3854337 missense probably damaging 1.00
R3940:Calm5 UTSW 13 3854485 missense possibly damaging 0.87
R4563:Calm5 UTSW 13 3854402 nonsense probably null
R4793:Calm5 UTSW 13 3854401 missense probably benign 0.06
R5585:Calm5 UTSW 13 3854372 missense possibly damaging 0.71
R5869:Calm5 UTSW 13 3854321 splice site probably benign
R6125:Calm5 UTSW 13 3854491 nonsense probably null
R7621:Calm5 UTSW 13 3854629 missense possibly damaging 0.75
R8062:Calm5 UTSW 13 3854405 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTGACACCAAGCTCAGAAG -3'
(R):5'- ACATGGATCATGCCCTCCAG -3'

Sequencing Primer
(F):5'- GCTCAGAAGCTTTGTAAGGTAC -3'
(R):5'- AGCTCCTCCTGGGAAAGC -3'
Posted On2016-12-15