Incidental Mutation 'R5775:Ryr2'
ID 448746
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission 043374-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5775 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 11553102-12106945 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11769962 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1035 (Y1035C)
Ref Sequence ENSEMBL: ENSMUSP00000127991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156] [ENSMUST00000220597]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000021750
AA Change: Y1035C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: Y1035C

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170156
AA Change: Y1035C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: Y1035C

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222386
Meta Mutation Damage Score 0.5894 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 (GRCm38) D753G possibly damaging Het
AF067061 T A 13: 120,263,939 (GRCm38) C46* probably null Het
Arpc2 T A 1: 74,255,949 (GRCm38) probably null Het
Atxn2 C T 5: 121,813,449 (GRCm38) T619M probably damaging Het
Cacna1s T C 1: 136,108,122 (GRCm38) Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 (GRCm38) L20S probably damaging Het
Carmil1 T C 13: 24,276,537 (GRCm38) I20V probably benign Het
Cd177 T C 7: 24,752,268 (GRCm38) E441G probably damaging Het
Cd63 T A 10: 128,910,430 (GRCm38) C9S probably damaging Het
Cep250 A C 2: 155,969,374 (GRCm38) D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 (GRCm38) P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 (GRCm38) V264A probably benign Het
Dennd6a T A 14: 26,619,373 (GRCm38) L214* probably null Het
Dna2 A G 10: 62,949,242 (GRCm38) N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 (GRCm38) V77I probably benign Het
Eml1 A T 12: 108,506,554 (GRCm38) Y207F probably damaging Het
Epha6 C T 16: 59,818,994 (GRCm38) R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 (GRCm38) S105T probably benign Het
Esp3 T A 17: 40,633,577 (GRCm38) S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 (GRCm38) A8V probably benign Het
Fut1 A C 7: 45,619,462 (GRCm38) D280A probably damaging Het
Gm13998 G T 2: 119,878,411 (GRCm38) noncoding transcript Het
Gm7247 C T 14: 51,364,348 (GRCm38) S26F probably benign Het
H2afz T C 3: 137,865,619 (GRCm38) Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 (GRCm38) I426V probably damaging Het
Kdm4c T G 4: 74,359,431 (GRCm38) V774G probably damaging Het
Mrc2 G A 11: 105,337,813 (GRCm38) V673I probably benign Het
Mtnr1b G A 9: 15,862,872 (GRCm38) A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 (GRCm38) M116K probably damaging Het
Olfr889 A T 9: 38,116,127 (GRCm38) E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 (GRCm38) V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 (GRCm38) E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 (GRCm38) T53M probably damaging Het
Pigo T C 4: 43,023,475 (GRCm38) D233G probably damaging Het
Pmm1 A T 15: 81,951,955 (GRCm38) I152N probably benign Het
Pot1a A T 6: 25,757,298 (GRCm38) probably null Het
Ppp1r12b G T 1: 134,876,042 (GRCm38) L460I probably benign Het
Prrc2a T C 17: 35,158,487 (GRCm38) D565G unknown Het
Psd C A 19: 46,314,772 (GRCm38) E724* probably null Het
Rasa2 C T 9: 96,577,468 (GRCm38) probably null Het
Rsbn1 A T 3: 103,962,572 (GRCm38) Q783L possibly damaging Het
Sec24d C T 3: 123,290,460 (GRCm38) A96V probably benign Het
Sec61a2 A T 2: 5,882,774 (GRCm38) probably null Het
Sec62 A G 3: 30,793,287 (GRCm38) probably benign Het
Tmem132b T A 5: 125,638,330 (GRCm38) probably null Het
Tnip3 A G 6: 65,614,757 (GRCm38) S247G probably benign Het
Traf3 A G 12: 111,252,728 (GRCm38) K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 (GRCm38) I713N probably damaging Het
Unc5c A G 3: 141,828,520 (GRCm38) E860G probably damaging Het
Usp44 A G 10: 93,845,978 (GRCm38) S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 (GRCm38) noncoding transcript Het
Vps37a A G 8: 40,529,119 (GRCm38) H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 (GRCm38) D342E probably benign Het
Zfp354b A T 11: 50,922,820 (GRCm38) F426Y probably benign Het
Zfp462 C A 4: 55,010,590 (GRCm38) T852N probably damaging Het
Zfp987 T G 4: 146,124,935 (GRCm38) S312R probably benign Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11,834,092 (GRCm38) splice site probably benign
IGL00757:Ryr2 APN 13 11,618,604 (GRCm38) splice site probably null
IGL00838:Ryr2 APN 13 11,568,503 (GRCm38) missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11,585,478 (GRCm38) missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11,735,502 (GRCm38) missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11,703,544 (GRCm38) missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11,638,485 (GRCm38) critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11,587,239 (GRCm38) missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11,556,685 (GRCm38) missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11,591,352 (GRCm38) missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11,742,036 (GRCm38) missense probably benign 0.10
IGL01419:Ryr2 APN 13 11,799,837 (GRCm38) missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11,851,204 (GRCm38) missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11,721,790 (GRCm38) missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11,721,761 (GRCm38) missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11,601,758 (GRCm38) critical splice donor site probably null
IGL01611:Ryr2 APN 13 11,591,316 (GRCm38) missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11,594,968 (GRCm38) missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11,692,677 (GRCm38) missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11,585,480 (GRCm38) missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11,601,842 (GRCm38) missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11,595,425 (GRCm38) missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11,554,550 (GRCm38) missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11,790,363 (GRCm38) missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11,790,363 (GRCm38) missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11,597,112 (GRCm38) missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11,747,564 (GRCm38) missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11,572,257 (GRCm38) missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11,792,762 (GRCm38) nonsense probably null
IGL02086:Ryr2 APN 13 11,735,556 (GRCm38) missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11,759,759 (GRCm38) missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11,737,873 (GRCm38) missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11,741,869 (GRCm38) missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11,730,388 (GRCm38) missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11,747,658 (GRCm38) splice site probably benign
IGL02369:Ryr2 APN 13 11,619,496 (GRCm38) missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11,722,721 (GRCm38) splice site probably benign
IGL02400:Ryr2 APN 13 11,605,244 (GRCm38) splice site probably benign
IGL02423:Ryr2 APN 13 11,745,198 (GRCm38) missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11,745,674 (GRCm38) missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11,705,699 (GRCm38) missense probably benign 0.15
IGL02602:Ryr2 APN 13 11,554,511 (GRCm38) utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11,605,189 (GRCm38) missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11,738,320 (GRCm38) missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11,655,677 (GRCm38) missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11,595,190 (GRCm38) missense probably benign 0.21
IGL02876:Ryr2 APN 13 11,707,793 (GRCm38) missense probably benign 0.39
IGL02878:Ryr2 APN 13 11,918,319 (GRCm38) missense probably benign 0.10
IGL02887:Ryr2 APN 13 11,591,269 (GRCm38) missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11,759,835 (GRCm38) missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11,684,479 (GRCm38) missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11,643,902 (GRCm38) critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11,635,582 (GRCm38) splice site probably benign
IGL03152:Ryr2 APN 13 11,853,150 (GRCm38) missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11,742,023 (GRCm38) nonsense probably null
IGL03180:Ryr2 APN 13 11,568,563 (GRCm38) missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11,724,387 (GRCm38) splice site probably benign
IGL03390:Ryr2 APN 13 11,772,416 (GRCm38) missense probably benign
IGL03410:Ryr2 APN 13 11,588,147 (GRCm38) missense probably damaging 0.99
Arruda UTSW 13 11,643,895 (GRCm38) missense probably damaging 1.00
Arruda2 UTSW 13 11,879,496 (GRCm38) missense probably damaging 1.00
Arruda3 UTSW 13 11,555,448 (GRCm38) missense possibly damaging 0.91
barricuda UTSW 13 11,595,014 (GRCm38) missense probably benign 0.06
BB006:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
BB006:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
BB016:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11,717,141 (GRCm38) splice site probably benign
IGL02799:Ryr2 UTSW 13 11,665,962 (GRCm38) missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11,761,306 (GRCm38) missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11,707,796 (GRCm38) missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11,594,755 (GRCm38) missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11,555,448 (GRCm38) missense probably benign 0.29
R0003:Ryr2 UTSW 13 11,824,379 (GRCm38) missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11,665,919 (GRCm38) missense probably benign
R0018:Ryr2 UTSW 13 11,595,223 (GRCm38) missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11,595,784 (GRCm38) missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11,595,784 (GRCm38) missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11,669,038 (GRCm38) missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11,869,116 (GRCm38) critical splice donor site probably null
R0062:Ryr2 UTSW 13 11,869,116 (GRCm38) critical splice donor site probably null
R0080:Ryr2 UTSW 13 11,568,475 (GRCm38) missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11,709,921 (GRCm38) missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11,714,548 (GRCm38) missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11,676,251 (GRCm38) splice site probably benign
R0226:Ryr2 UTSW 13 11,772,556 (GRCm38) missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11,716,977 (GRCm38) missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11,668,839 (GRCm38) missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11,705,684 (GRCm38) missense probably benign 0.45
R0415:Ryr2 UTSW 13 11,869,156 (GRCm38) missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11,834,095 (GRCm38) splice site probably benign
R0558:Ryr2 UTSW 13 11,799,861 (GRCm38) missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11,638,443 (GRCm38) missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11,731,669 (GRCm38) missense probably benign 0.02
R0586:Ryr2 UTSW 13 11,635,559 (GRCm38) missense probably null
R0601:Ryr2 UTSW 13 11,705,633 (GRCm38) critical splice donor site probably null
R0610:Ryr2 UTSW 13 11,622,952 (GRCm38) missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11,724,333 (GRCm38) missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11,566,885 (GRCm38) missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11,554,529 (GRCm38) missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11,738,126 (GRCm38) missense probably benign 0.35
R0884:Ryr2 UTSW 13 11,554,529 (GRCm38) missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11,669,969 (GRCm38) missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11,945,981 (GRCm38) missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11,660,113 (GRCm38) missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11,759,703 (GRCm38) missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11,883,043 (GRCm38) critical splice donor site probably null
R1296:Ryr2 UTSW 13 11,687,879 (GRCm38) splice site probably benign
R1400:Ryr2 UTSW 13 11,595,076 (GRCm38) missense probably benign 0.08
R1439:Ryr2 UTSW 13 11,714,503 (GRCm38) splice site probably benign
R1443:Ryr2 UTSW 13 11,779,266 (GRCm38) missense probably benign 0.19
R1446:Ryr2 UTSW 13 11,738,149 (GRCm38) missense probably benign 0.09
R1458:Ryr2 UTSW 13 11,727,022 (GRCm38) missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11,601,841 (GRCm38) missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11,554,592 (GRCm38) missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11,554,549 (GRCm38) nonsense probably null
R1551:Ryr2 UTSW 13 11,785,143 (GRCm38) critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11,759,677 (GRCm38) missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11,794,563 (GRCm38) missense probably benign 0.01
R1645:Ryr2 UTSW 13 11,718,482 (GRCm38) nonsense probably null
R1686:Ryr2 UTSW 13 11,603,779 (GRCm38) splice site probably benign
R1696:Ryr2 UTSW 13 11,731,657 (GRCm38) missense probably benign 0.02
R1708:Ryr2 UTSW 13 11,587,442 (GRCm38) splice site probably null
R1728:Ryr2 UTSW 13 11,587,422 (GRCm38) missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11,790,267 (GRCm38) missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11,745,176 (GRCm38) critical splice donor site probably null
R1776:Ryr2 UTSW 13 11,745,176 (GRCm38) critical splice donor site probably null
R1783:Ryr2 UTSW 13 11,700,371 (GRCm38) nonsense probably null
R1801:Ryr2 UTSW 13 11,595,281 (GRCm38) missense probably benign 0.01
R1812:Ryr2 UTSW 13 11,560,586 (GRCm38) missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11,587,316 (GRCm38) missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11,769,878 (GRCm38) missense probably benign 0.06
R1868:Ryr2 UTSW 13 11,731,700 (GRCm38) missense probably benign 0.02
R1869:Ryr2 UTSW 13 11,662,075 (GRCm38) missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11,738,356 (GRCm38) missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11,658,958 (GRCm38) nonsense probably null
R1897:Ryr2 UTSW 13 11,750,932 (GRCm38) missense probably benign 0.09
R1899:Ryr2 UTSW 13 11,591,336 (GRCm38) missense probably benign
R1909:Ryr2 UTSW 13 11,700,349 (GRCm38) missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11,556,698 (GRCm38) missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11,668,962 (GRCm38) missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11,731,723 (GRCm38) missense probably benign 0.10
R1956:Ryr2 UTSW 13 11,681,080 (GRCm38) missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11,585,402 (GRCm38) splice site probably null
R2018:Ryr2 UTSW 13 11,851,188 (GRCm38) missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11,851,188 (GRCm38) missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11,595,736 (GRCm38) missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11,665,878 (GRCm38) splice site probably null
R2088:Ryr2 UTSW 13 11,662,229 (GRCm38) missense probably benign 0.04
R2089:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2127:Ryr2 UTSW 13 11,712,195 (GRCm38) missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11,560,607 (GRCm38) missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11,577,873 (GRCm38) missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11,705,793 (GRCm38) nonsense probably null
R2207:Ryr2 UTSW 13 11,810,937 (GRCm38) missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11,662,260 (GRCm38) missense probably benign 0.18
R2258:Ryr2 UTSW 13 11,738,216 (GRCm38) missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11,738,242 (GRCm38) missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11,591,237 (GRCm38) missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11,801,848 (GRCm38) missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11,759,703 (GRCm38) missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11,593,093 (GRCm38) missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11,593,093 (GRCm38) missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11,761,349 (GRCm38) missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11,761,349 (GRCm38) missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11,772,580 (GRCm38) critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11,588,159 (GRCm38) missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11,738,209 (GRCm38) missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11,772,427 (GRCm38) missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11,918,414 (GRCm38) missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11,692,682 (GRCm38) missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11,779,267 (GRCm38) missense probably benign 0.22
R4127:Ryr2 UTSW 13 11,587,437 (GRCm38) missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11,737,873 (GRCm38) missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11,750,725 (GRCm38) missense probably benign 0.20
R4355:Ryr2 UTSW 13 11,649,812 (GRCm38) missense probably benign 0.05
R4384:Ryr2 UTSW 13 11,605,233 (GRCm38) missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11,717,066 (GRCm38) nonsense probably null
R4430:Ryr2 UTSW 13 11,735,527 (GRCm38) missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12,106,415 (GRCm38) missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11,749,509 (GRCm38) missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11,750,685 (GRCm38) splice site probably null
R4668:Ryr2 UTSW 13 11,593,117 (GRCm38) missense probably benign
R4677:Ryr2 UTSW 13 11,706,667 (GRCm38) missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11,824,369 (GRCm38) missense probably benign 0.34
R4680:Ryr2 UTSW 13 11,595,233 (GRCm38) missense probably benign 0.04
R4685:Ryr2 UTSW 13 11,692,646 (GRCm38) missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11,716,998 (GRCm38) missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11,737,753 (GRCm38) missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11,657,047 (GRCm38) missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11,708,227 (GRCm38) missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11,687,932 (GRCm38) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,687,932 (GRCm38) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,708,227 (GRCm38) missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11,717,097 (GRCm38) missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11,655,698 (GRCm38) missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11,745,752 (GRCm38) missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11,668,820 (GRCm38) missense probably damaging 0.99
R4880:Ryr2 UTSW 13 11,752,218 (GRCm38) missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11,594,986 (GRCm38) missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11,594,986 (GRCm38) missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11,709,963 (GRCm38) missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11,945,945 (GRCm38) missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11,742,011 (GRCm38) missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11,785,080 (GRCm38) missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11,833,992 (GRCm38) missense probably benign 0.00
R4964:Ryr2 UTSW 13 11,714,611 (GRCm38) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,714,611 (GRCm38) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,833,992 (GRCm38) missense probably benign 0.00
R4997:Ryr2 UTSW 13 11,595,306 (GRCm38) missense probably benign 0.09
R4998:Ryr2 UTSW 13 11,643,895 (GRCm38) missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11,587,254 (GRCm38) missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11,635,536 (GRCm38) missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11,700,354 (GRCm38) missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11,712,243 (GRCm38) nonsense probably null
R5135:Ryr2 UTSW 13 11,662,130 (GRCm38) missense probably benign 0.05
R5138:Ryr2 UTSW 13 11,660,289 (GRCm38) missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11,752,321 (GRCm38) missense probably benign
R5187:Ryr2 UTSW 13 11,772,452 (GRCm38) missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11,638,430 (GRCm38) critical splice donor site probably null
R5262:Ryr2 UTSW 13 11,772,437 (GRCm38) missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11,690,363 (GRCm38) missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11,556,658 (GRCm38) missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11,655,713 (GRCm38) missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11,705,656 (GRCm38) missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11,705,701 (GRCm38) missense probably null 0.15
R5509:Ryr2 UTSW 13 11,745,601 (GRCm38) missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11,687,909 (GRCm38) missense probably benign 0.01
R5571:Ryr2 UTSW 13 11,555,448 (GRCm38) missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11,595,014 (GRCm38) missense probably benign 0.06
R5619:Ryr2 UTSW 13 11,708,202 (GRCm38) missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11,601,805 (GRCm38) missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11,595,582 (GRCm38) missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11,759,836 (GRCm38) missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11,603,732 (GRCm38) missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11,560,574 (GRCm38) missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11,584,154 (GRCm38) missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11,790,332 (GRCm38) missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11,687,902 (GRCm38) missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11,660,122 (GRCm38) missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11,726,953 (GRCm38) missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11,662,238 (GRCm38) nonsense probably null
R5974:Ryr2 UTSW 13 11,714,511 (GRCm38) splice site probably null
R6104:Ryr2 UTSW 13 11,799,825 (GRCm38) missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11,792,689 (GRCm38) missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11,669,017 (GRCm38) missense probably benign
R6208:Ryr2 UTSW 13 11,895,220 (GRCm38) missense probably benign 0.04
R6217:Ryr2 UTSW 13 11,834,078 (GRCm38) missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11,660,107 (GRCm38) missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11,879,496 (GRCm38) missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11,761,396 (GRCm38) missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11,662,383 (GRCm38) missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11,834,007 (GRCm38) missense probably benign 0.29
R6548:Ryr2 UTSW 13 11,668,821 (GRCm38) missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11,594,723 (GRCm38) missense probably benign 0.01
R6623:Ryr2 UTSW 13 11,710,065 (GRCm38) missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11,595,643 (GRCm38) missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11,594,723 (GRCm38) missense probably benign 0.01
R6770:Ryr2 UTSW 13 11,738,462 (GRCm38) missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11,686,966 (GRCm38) missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11,726,930 (GRCm38) missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11,829,654 (GRCm38) missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11,827,559 (GRCm38) missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11,745,601 (GRCm38) missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11,566,948 (GRCm38) missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11,801,243 (GRCm38) missense probably benign 0.28
R6997:Ryr2 UTSW 13 11,654,380 (GRCm38) missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11,712,166 (GRCm38) missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11,794,605 (GRCm38) missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11,824,400 (GRCm38) missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11,649,776 (GRCm38) missense probably benign 0.10
R7125:Ryr2 UTSW 13 11,669,987 (GRCm38) missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11,655,713 (GRCm38) missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11,668,811 (GRCm38) critical splice donor site probably null
R7131:Ryr2 UTSW 13 11,640,327 (GRCm38) missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11,810,908 (GRCm38) missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11,801,177 (GRCm38) missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11,686,978 (GRCm38) missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11,759,757 (GRCm38) missense probably benign
R7189:Ryr2 UTSW 13 11,883,123 (GRCm38) missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11,665,913 (GRCm38) missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11,597,146 (GRCm38) missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11,738,194 (GRCm38) missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11,745,631 (GRCm38) missense probably benign
R7365:Ryr2 UTSW 13 11,640,275 (GRCm38) missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11,785,111 (GRCm38) missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11,735,620 (GRCm38) missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11,556,748 (GRCm38) splice site probably null
R7425:Ryr2 UTSW 13 11,705,644 (GRCm38) missense probably benign 0.20
R7444:Ryr2 UTSW 13 11,555,463 (GRCm38) missense probably benign 0.25
R7456:Ryr2 UTSW 13 11,752,282 (GRCm38) missense probably benign
R7460:Ryr2 UTSW 13 11,705,710 (GRCm38) missense probably benign 0.10
R7474:Ryr2 UTSW 13 11,594,876 (GRCm38) missense probably benign 0.04
R7543:Ryr2 UTSW 13 11,638,431 (GRCm38) critical splice donor site probably null
R7549:Ryr2 UTSW 13 11,737,985 (GRCm38) missense probably benign 0.15
R7558:Ryr2 UTSW 13 11,799,825 (GRCm38) missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11,560,653 (GRCm38) missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11,761,327 (GRCm38) missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11,761,315 (GRCm38) missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11,690,333 (GRCm38) missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11,730,343 (GRCm38) missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11,751,011 (GRCm38) missense probably benign
R7797:Ryr2 UTSW 13 11,801,180 (GRCm38) missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11,827,607 (GRCm38) missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11,706,623 (GRCm38) nonsense probably null
R7872:Ryr2 UTSW 13 11,595,724 (GRCm38) missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11,792,748 (GRCm38) missense probably benign 0.01
R7929:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
R7952:Ryr2 UTSW 13 11,646,427 (GRCm38) splice site probably null
R8008:Ryr2 UTSW 13 11,657,094 (GRCm38) missense probably benign 0.30
R8011:Ryr2 UTSW 13 11,588,140 (GRCm38) critical splice donor site probably null
R8097:Ryr2 UTSW 13 11,945,995 (GRCm38) missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11,603,698 (GRCm38) missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11,827,553 (GRCm38) missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11,595,506 (GRCm38) nonsense probably null
R8351:Ryr2 UTSW 13 11,799,832 (GRCm38) missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11,668,935 (GRCm38) missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11,684,478 (GRCm38) missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11,659,008 (GRCm38) missense probably benign 0.00
R8509:Ryr2 UTSW 13 11,577,778 (GRCm38) critical splice donor site probably null
R8551:Ryr2 UTSW 13 11,560,593 (GRCm38) missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11,687,989 (GRCm38) missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11,686,947 (GRCm38) missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11,668,969 (GRCm38) missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11,735,623 (GRCm38) missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11,558,048 (GRCm38) missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11,779,266 (GRCm38) missense probably benign 0.19
R8889:Ryr2 UTSW 13 11,785,104 (GRCm38) missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11,799,882 (GRCm38) missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11,595,038 (GRCm38) missense probably benign 0.00
R9013:Ryr2 UTSW 13 11,603,732 (GRCm38) missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11,594,786 (GRCm38) missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11,738,103 (GRCm38) nonsense probably null
R9056:Ryr2 UTSW 13 11,595,931 (GRCm38) missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11,601,838 (GRCm38) missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11,603,855 (GRCm38) intron probably benign
R9116:Ryr2 UTSW 13 11,572,299 (GRCm38) missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11,654,406 (GRCm38) missense probably benign 0.28
R9148:Ryr2 UTSW 13 11,885,538 (GRCm38) missense probably benign 0.02
R9210:Ryr2 UTSW 13 11,829,674 (GRCm38) missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11,829,674 (GRCm38) missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11,595,886 (GRCm38) missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11,883,116 (GRCm38) missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11,750,968 (GRCm38) missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11,883,090 (GRCm38) missense probably benign 0.10
R9278:Ryr2 UTSW 13 11,883,090 (GRCm38) missense probably benign 0.10
R9309:Ryr2 UTSW 13 11,706,692 (GRCm38) missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11,883,116 (GRCm38) missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11,681,087 (GRCm38) missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11,794,573 (GRCm38) missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11,772,577 (GRCm38) missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11,737,794 (GRCm38) missense probably benign 0.00
R9467:Ryr2 UTSW 13 11,556,604 (GRCm38) missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11,587,215 (GRCm38) critical splice donor site probably null
R9562:Ryr2 UTSW 13 11,745,218 (GRCm38) missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11,668,962 (GRCm38) missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11,722,760 (GRCm38) missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11,687,049 (GRCm38) missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11,594,899 (GRCm38) missense probably benign 0.13
R9776:Ryr2 UTSW 13 11,692,713 (GRCm38) missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11,869,156 (GRCm38) missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11,703,501 (GRCm38) missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11,643,803 (GRCm38) critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11,598,611 (GRCm38) critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11,794,549 (GRCm38) nonsense probably null
Z1177:Ryr2 UTSW 13 11,750,873 (GRCm38) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TAGACCATCAGCCTTGGGTG -3'
(R):5'- GCTGGTGACTCCTTAAGTATGGAC -3'

Sequencing Primer
(F):5'- ATCAGCCTTGGGTGGACAC -3'
(R):5'- ACTCCTTAAGTATGGACTTTTGGC -3'
Posted On 2016-12-15