Mutagenetix > Incidental Mutation

Incidental Mutation 'R5775:Ryr2'

448746

Institutional Source

Beutler Lab

Gene Symbol

Ryr2

Ensembl Gene

ENSMUSG00000021313

Gene Name

ryanodine receptor 2, cardiac

Synonyms

9330127I20Rik

MMRRC Submission

043374-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5775 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11553102-12106945 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11769962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1035 (Y1035C)

Ref Sequence

ENSEMBL: ENSMUSP00000127991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156] [ENSMUST00000220597]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000021750
AA Change: Y1035C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: Y1035C

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	454	648	3.1e-65	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	862	952	1.8e-36	PFAM
Pfam:RyR	976	1066	1.1e-32	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2122	2331	1.2e-71	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2700	2790	1.1e-33	PFAM
Pfam:RyR	2820	2904	7.1e-27	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3829	3947	3.1e-36	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.7e-96	PFAM
Pfam:Ion_trans	4710	4877	8e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170156
AA Change: Y1035C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: Y1035C

Domain	Start	End	E-Value	Type
MIR	110	165	4.19e-2	SMART
MIR	172	217	9.25e-4	SMART
MIR	225	280	1.8e-1	SMART
MIR	286	376	2.22e-24	SMART
Pfam:RYDR_ITPR	451	655	3.5e-73	PFAM
SPRY	670	808	1.56e-30	SMART
Pfam:RyR	861	955	1.4e-33	PFAM
Pfam:RyR	975	1069	9.2e-34	PFAM
SPRY	1098	1221	5.07e-39	SMART
SPRY	1423	1562	7.47e-28	SMART
low complexity region	1643	1653	N/A	INTRINSIC
low complexity region	1872	1891	N/A	INTRINSIC
Pfam:RYDR_ITPR	2120	2331	3.9e-65	PFAM
low complexity region	2372	2379	N/A	INTRINSIC
low complexity region	2416	2426	N/A	INTRINSIC
low complexity region	2497	2510	N/A	INTRINSIC
Pfam:RyR	2699	2793	1.1e-37	PFAM
Pfam:RyR	2819	2907	9.4e-34	PFAM
PDB:2BCX\|B	3580	3609	9e-12	PDB
low complexity region	3700	3720	N/A	INTRINSIC
Pfam:RIH_assoc	3825	3958	2.3e-42	PFAM
EFh	4026	4054	1.36e0	SMART
EFh	4061	4089	5.92e1	SMART
low complexity region	4218	4227	N/A	INTRINSIC
low complexity region	4256	4273	N/A	INTRINSIC
transmembrane domain	4278	4300	N/A	INTRINSIC
low complexity region	4309	4317	N/A	INTRINSIC
Pfam:RR_TM4-6	4332	4598	5.1e-93	PFAM
Pfam:Ion_trans	4705	4865	9.3e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000220597

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222386

Meta Mutation Damage Score

0.5894

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (59/61)

MGI Phenotype

Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]

Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6a	A	G	12: 113,546,266 (GRCm38)	D753G	possibly damaging	Het
AF067061	T	A	13: 120,263,939 (GRCm38)	C46*	probably null	Het
Arpc2	T	A	1: 74,255,949 (GRCm38)		probably null	Het
Atxn2	C	T	5: 121,813,449 (GRCm38)	T619M	probably damaging	Het
Cacna1s	T	C	1: 136,108,122 (GRCm38)	Y1120H	probably damaging	Het
Calm5	T	C	13: 3,854,435 (GRCm38)	L20S	probably damaging	Het
Carmil1	T	C	13: 24,276,537 (GRCm38)	I20V	probably benign	Het
Cd177	T	C	7: 24,752,268 (GRCm38)	E441G	probably damaging	Het
Cd63	T	A	10: 128,910,430 (GRCm38)	C9S	probably damaging	Het
Cep250	A	C	2: 155,969,374 (GRCm38)	D380A	possibly damaging	Het
Col5a3	G	T	9: 20,801,072 (GRCm38)	P509Q	unknown	Het
Cyp11b2	A	G	15: 74,853,478 (GRCm38)	V264A	probably benign	Het
Dennd6a	T	A	14: 26,619,373 (GRCm38)	L214*	probably null	Het
Dna2	A	G	10: 62,949,242 (GRCm38)	N46S	possibly damaging	Het
Elovl1	G	A	4: 118,430,897 (GRCm38)	V77I	probably benign	Het
Eml1	A	T	12: 108,506,554 (GRCm38)	Y207F	probably damaging	Het
Epha6	C	T	16: 59,818,994 (GRCm38)	R839Q	possibly damaging	Het
Erlec1	A	T	11: 30,943,848 (GRCm38)	S105T	probably benign	Het
Esp3	T	A	17: 40,633,577 (GRCm38)	S37T	possibly damaging	Het
Foxh1	G	A	15: 76,669,849 (GRCm38)	A8V	probably benign	Het
Fut1	A	C	7: 45,619,462 (GRCm38)	D280A	probably damaging	Het
Gm13998	G	T	2: 119,878,411 (GRCm38)		noncoding transcript	Het
Gm7247	C	T	14: 51,364,348 (GRCm38)	S26F	probably benign	Het
H2afz	T	C	3: 137,865,619 (GRCm38)	Y61H	probably damaging	Het
Kcns1	T	C	2: 164,164,766 (GRCm38)	I426V	probably damaging	Het
Kdm4c	T	G	4: 74,359,431 (GRCm38)	V774G	probably damaging	Het
Mrc2	G	A	11: 105,337,813 (GRCm38)	V673I	probably benign	Het
Mtnr1b	G	A	9: 15,862,872 (GRCm38)	A297V	possibly damaging	Het
Olfr1173	A	T	2: 88,274,701 (GRCm38)	M116K	probably damaging	Het
Olfr889	A	T	9: 38,116,127 (GRCm38)	E110D	probably damaging	Het
Osbpl5	A	T	7: 143,704,529 (GRCm38)	V346D	probably benign	Het
Pdzrn4	A	T	15: 92,757,681 (GRCm38)	E485V	probably damaging	Het
Pgpep1	G	A	8: 70,652,451 (GRCm38)	T53M	probably damaging	Het
Pigo	T	C	4: 43,023,475 (GRCm38)	D233G	probably damaging	Het
Pmm1	A	T	15: 81,951,955 (GRCm38)	I152N	probably benign	Het
Pot1a	A	T	6: 25,757,298 (GRCm38)		probably null	Het
Ppp1r12b	G	T	1: 134,876,042 (GRCm38)	L460I	probably benign	Het
Prrc2a	T	C	17: 35,158,487 (GRCm38)	D565G	unknown	Het
Psd	C	A	19: 46,314,772 (GRCm38)	E724*	probably null	Het
Rasa2	C	T	9: 96,577,468 (GRCm38)		probably null	Het
Rsbn1	A	T	3: 103,962,572 (GRCm38)	Q783L	possibly damaging	Het
Sec24d	C	T	3: 123,290,460 (GRCm38)	A96V	probably benign	Het
Sec61a2	A	T	2: 5,882,774 (GRCm38)		probably null	Het
Sec62	A	G	3: 30,793,287 (GRCm38)		probably benign	Het
Tmem132b	T	A	5: 125,638,330 (GRCm38)		probably null	Het
Tnip3	A	G	6: 65,614,757 (GRCm38)	S247G	probably benign	Het
Traf3	A	G	12: 111,252,728 (GRCm38)	K263R	possibly damaging	Het
Tubgcp3	A	T	8: 12,625,056 (GRCm38)	I713N	probably damaging	Het
Unc5c	A	G	3: 141,828,520 (GRCm38)	E860G	probably damaging	Het
Usp44	A	G	10: 93,845,978 (GRCm38)	S97G	possibly damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397 (GRCm38)		noncoding transcript	Het
Vps37a	A	G	8: 40,529,119 (GRCm38)	H109R	probably damaging	Het
Wfikkn2	G	T	11: 94,238,288 (GRCm38)	D342E	probably benign	Het
Zfp354b	A	T	11: 50,922,820 (GRCm38)	F426Y	probably benign	Het
Zfp462	C	A	4: 55,010,590 (GRCm38)	T852N	probably damaging	Het
Zfp987	T	G	4: 146,124,935 (GRCm38)	S312R	probably benign	Het

Other mutations in Ryr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Ryr2	APN	13	11,834,092 (GRCm38)	splice site	probably benign
IGL00757:Ryr2	APN	13	11,618,604 (GRCm38)	splice site	probably null
IGL00838:Ryr2	APN	13	11,568,503 (GRCm38)	missense	probably damaging	0.98
IGL00849:Ryr2	APN	13	11,585,478 (GRCm38)	missense	possibly damaging	0.91
IGL00987:Ryr2	APN	13	11,735,502 (GRCm38)	missense	probably damaging	0.99
IGL01096:Ryr2	APN	13	11,703,544 (GRCm38)	missense	probably damaging	1.00
IGL01313:Ryr2	APN	13	11,638,485 (GRCm38)	critical splice acceptor site	probably null
IGL01349:Ryr2	APN	13	11,587,239 (GRCm38)	missense	possibly damaging	0.93
IGL01391:Ryr2	APN	13	11,556,685 (GRCm38)	missense	possibly damaging	0.96
IGL01401:Ryr2	APN	13	11,591,352 (GRCm38)	missense	possibly damaging	0.80
IGL01412:Ryr2	APN	13	11,742,036 (GRCm38)	missense	probably benign	0.10
IGL01419:Ryr2	APN	13	11,799,837 (GRCm38)	missense	possibly damaging	0.51
IGL01432:Ryr2	APN	13	11,851,204 (GRCm38)	missense	possibly damaging	0.63
IGL01533:Ryr2	APN	13	11,721,790 (GRCm38)	missense	probably damaging	1.00
IGL01571:Ryr2	APN	13	11,721,761 (GRCm38)	missense	probably damaging	1.00
IGL01584:Ryr2	APN	13	11,601,758 (GRCm38)	critical splice donor site	probably null
IGL01611:Ryr2	APN	13	11,591,316 (GRCm38)	missense	possibly damaging	0.67
IGL01632:Ryr2	APN	13	11,594,968 (GRCm38)	missense	probably damaging	0.97
IGL01643:Ryr2	APN	13	11,692,677 (GRCm38)	missense	possibly damaging	0.94
IGL01647:Ryr2	APN	13	11,585,480 (GRCm38)	missense	probably damaging	1.00
IGL01730:Ryr2	APN	13	11,601,842 (GRCm38)	missense	possibly damaging	0.86
IGL01834:Ryr2	APN	13	11,595,425 (GRCm38)	missense	possibly damaging	0.71
IGL01921:Ryr2	APN	13	11,554,550 (GRCm38)	missense	possibly damaging	0.96
IGL01937:Ryr2	APN	13	11,790,363 (GRCm38)	missense	probably damaging	1.00
IGL01945:Ryr2	APN	13	11,790,363 (GRCm38)	missense	probably damaging	1.00
IGL02027:Ryr2	APN	13	11,597,112 (GRCm38)	missense	probably damaging	1.00
IGL02060:Ryr2	APN	13	11,747,564 (GRCm38)	missense	probably damaging	1.00
IGL02065:Ryr2	APN	13	11,572,257 (GRCm38)	missense	possibly damaging	0.92
IGL02084:Ryr2	APN	13	11,792,762 (GRCm38)	nonsense	probably null
IGL02086:Ryr2	APN	13	11,735,556 (GRCm38)	missense	probably damaging	1.00
IGL02095:Ryr2	APN	13	11,759,759 (GRCm38)	missense	probably damaging	0.98
IGL02100:Ryr2	APN	13	11,737,873 (GRCm38)	missense	possibly damaging	0.92
IGL02122:Ryr2	APN	13	11,741,869 (GRCm38)	missense	probably damaging	1.00
IGL02202:Ryr2	APN	13	11,730,388 (GRCm38)	missense	probably damaging	0.97
IGL02202:Ryr2	APN	13	11,747,658 (GRCm38)	splice site	probably benign
IGL02369:Ryr2	APN	13	11,619,496 (GRCm38)	missense	possibly damaging	0.68
IGL02383:Ryr2	APN	13	11,722,721 (GRCm38)	splice site	probably benign
IGL02400:Ryr2	APN	13	11,605,244 (GRCm38)	splice site	probably benign
IGL02423:Ryr2	APN	13	11,745,198 (GRCm38)	missense	probably damaging	1.00
IGL02425:Ryr2	APN	13	11,745,674 (GRCm38)	missense	probably damaging	0.99
IGL02458:Ryr2	APN	13	11,705,699 (GRCm38)	missense	probably benign	0.15
IGL02602:Ryr2	APN	13	11,554,511 (GRCm38)	utr 3 prime	probably benign
IGL02694:Ryr2	APN	13	11,605,189 (GRCm38)	missense	probably damaging	1.00
IGL02726:Ryr2	APN	13	11,738,320 (GRCm38)	missense	probably damaging	1.00
IGL02747:Ryr2	APN	13	11,655,677 (GRCm38)	missense	probably damaging	1.00
IGL02795:Ryr2	APN	13	11,595,190 (GRCm38)	missense	probably benign	0.21
IGL02876:Ryr2	APN	13	11,707,793 (GRCm38)	missense	probably benign	0.39
IGL02878:Ryr2	APN	13	11,918,319 (GRCm38)	missense	probably benign	0.10
IGL02887:Ryr2	APN	13	11,591,269 (GRCm38)	missense	probably damaging	0.97
IGL02926:Ryr2	APN	13	11,759,835 (GRCm38)	missense	probably damaging	0.99
IGL03030:Ryr2	APN	13	11,684,479 (GRCm38)	missense	probably damaging	0.99
IGL03064:Ryr2	APN	13	11,643,902 (GRCm38)	critical splice acceptor site	probably null
IGL03102:Ryr2	APN	13	11,635,582 (GRCm38)	splice site	probably benign
IGL03152:Ryr2	APN	13	11,853,150 (GRCm38)	missense	probably damaging	1.00
IGL03176:Ryr2	APN	13	11,742,023 (GRCm38)	nonsense	probably null
IGL03180:Ryr2	APN	13	11,568,563 (GRCm38)	missense	possibly damaging	0.95
IGL03213:Ryr2	APN	13	11,724,387 (GRCm38)	splice site	probably benign
IGL03390:Ryr2	APN	13	11,772,416 (GRCm38)	missense	probably benign
IGL03410:Ryr2	APN	13	11,588,147 (GRCm38)	missense	probably damaging	0.99
Arruda	UTSW	13	11,643,895 (GRCm38)	missense	probably damaging	1.00
Arruda2	UTSW	13	11,879,496 (GRCm38)	missense	probably damaging	1.00
Arruda3	UTSW	13	11,555,448 (GRCm38)	missense	possibly damaging	0.91
barricuda	UTSW	13	11,595,014 (GRCm38)	missense	probably benign	0.06
BB006:Ryr2	UTSW	13	11,690,295 (GRCm38)	nonsense	probably null
BB006:Ryr2	UTSW	13	11,594,794 (GRCm38)	missense	probably damaging	1.00
BB016:Ryr2	UTSW	13	11,690,295 (GRCm38)	nonsense	probably null
BB016:Ryr2	UTSW	13	11,594,794 (GRCm38)	missense	probably damaging	1.00
H8562:Ryr2	UTSW	13	11,717,141 (GRCm38)	splice site	probably benign
IGL02799:Ryr2	UTSW	13	11,665,962 (GRCm38)	missense	probably damaging	1.00
IGL02991:Ryr2	UTSW	13	11,761,306 (GRCm38)	missense	probably damaging	0.99
PIT4142001:Ryr2	UTSW	13	11,707,796 (GRCm38)	missense	probably damaging	0.97
PIT4260001:Ryr2	UTSW	13	11,594,755 (GRCm38)	missense	possibly damaging	0.93
PIT4458001:Ryr2	UTSW	13	11,555,448 (GRCm38)	missense	probably benign	0.29
R0003:Ryr2	UTSW	13	11,824,379 (GRCm38)	missense	probably damaging	1.00
R0004:Ryr2	UTSW	13	11,665,919 (GRCm38)	missense	probably benign
R0018:Ryr2	UTSW	13	11,595,223 (GRCm38)	missense	possibly damaging	0.94
R0048:Ryr2	UTSW	13	11,595,784 (GRCm38)	missense	probably damaging	1.00
R0048:Ryr2	UTSW	13	11,595,784 (GRCm38)	missense	probably damaging	1.00
R0056:Ryr2	UTSW	13	11,669,038 (GRCm38)	missense	probably damaging	0.97
R0062:Ryr2	UTSW	13	11,869,116 (GRCm38)	critical splice donor site	probably null
R0062:Ryr2	UTSW	13	11,869,116 (GRCm38)	critical splice donor site	probably null
R0080:Ryr2	UTSW	13	11,568,475 (GRCm38)	missense	probably damaging	0.98
R0116:Ryr2	UTSW	13	11,709,921 (GRCm38)	missense	probably damaging	1.00
R0148:Ryr2	UTSW	13	11,714,548 (GRCm38)	missense	probably damaging	1.00
R0206:Ryr2	UTSW	13	11,676,251 (GRCm38)	splice site	probably benign
R0226:Ryr2	UTSW	13	11,772,556 (GRCm38)	missense	probably damaging	1.00
R0285:Ryr2	UTSW	13	11,716,977 (GRCm38)	missense	probably damaging	1.00
R0365:Ryr2	UTSW	13	11,668,839 (GRCm38)	missense	possibly damaging	0.90
R0401:Ryr2	UTSW	13	11,705,684 (GRCm38)	missense	probably benign	0.45
R0415:Ryr2	UTSW	13	11,869,156 (GRCm38)	missense	probably damaging	0.97
R0418:Ryr2	UTSW	13	11,834,095 (GRCm38)	splice site	probably benign
R0558:Ryr2	UTSW	13	11,799,861 (GRCm38)	missense	probably damaging	1.00
R0558:Ryr2	UTSW	13	11,638,443 (GRCm38)	missense	probably damaging	1.00
R0574:Ryr2	UTSW	13	11,731,669 (GRCm38)	missense	probably benign	0.02
R0586:Ryr2	UTSW	13	11,635,559 (GRCm38)	missense	probably null
R0601:Ryr2	UTSW	13	11,705,633 (GRCm38)	critical splice donor site	probably null
R0610:Ryr2	UTSW	13	11,622,952 (GRCm38)	missense	probably damaging	1.00
R0648:Ryr2	UTSW	13	11,724,333 (GRCm38)	missense	possibly damaging	0.86
R0727:Ryr2	UTSW	13	11,566,885 (GRCm38)	missense	probably damaging	1.00
R0743:Ryr2	UTSW	13	11,554,529 (GRCm38)	missense	probably damaging	0.99
R0821:Ryr2	UTSW	13	11,738,126 (GRCm38)	missense	probably benign	0.35
R0884:Ryr2	UTSW	13	11,554,529 (GRCm38)	missense	probably damaging	0.99
R1104:Ryr2	UTSW	13	11,669,969 (GRCm38)	missense	probably damaging	0.99
R1114:Ryr2	UTSW	13	11,945,981 (GRCm38)	missense	probably damaging	0.98
R1167:Ryr2	UTSW	13	11,660,113 (GRCm38)	missense	possibly damaging	0.94
R1238:Ryr2	UTSW	13	11,759,703 (GRCm38)	missense	probably damaging	1.00
R1239:Ryr2	UTSW	13	11,883,043 (GRCm38)	critical splice donor site	probably null
R1296:Ryr2	UTSW	13	11,687,879 (GRCm38)	splice site	probably benign
R1400:Ryr2	UTSW	13	11,595,076 (GRCm38)	missense	probably benign	0.08
R1439:Ryr2	UTSW	13	11,714,503 (GRCm38)	splice site	probably benign
R1443:Ryr2	UTSW	13	11,779,266 (GRCm38)	missense	probably benign	0.19
R1446:Ryr2	UTSW	13	11,738,149 (GRCm38)	missense	probably benign	0.09
R1458:Ryr2	UTSW	13	11,727,022 (GRCm38)	missense	probably damaging	0.97
R1497:Ryr2	UTSW	13	11,601,841 (GRCm38)	missense	probably damaging	0.99
R1505:Ryr2	UTSW	13	11,554,592 (GRCm38)	missense	possibly damaging	0.84
R1548:Ryr2	UTSW	13	11,554,549 (GRCm38)	nonsense	probably null
R1551:Ryr2	UTSW	13	11,785,143 (GRCm38)	critical splice acceptor site	probably null
R1567:Ryr2	UTSW	13	11,759,677 (GRCm38)	missense	possibly damaging	0.87
R1581:Ryr2	UTSW	13	11,794,563 (GRCm38)	missense	probably benign	0.01
R1645:Ryr2	UTSW	13	11,718,482 (GRCm38)	nonsense	probably null
R1686:Ryr2	UTSW	13	11,603,779 (GRCm38)	splice site	probably benign
R1696:Ryr2	UTSW	13	11,731,657 (GRCm38)	missense	probably benign	0.02
R1708:Ryr2	UTSW	13	11,587,442 (GRCm38)	splice site	probably null
R1728:Ryr2	UTSW	13	11,587,422 (GRCm38)	missense	possibly damaging	0.94
R1745:Ryr2	UTSW	13	11,790,267 (GRCm38)	missense	probably damaging	1.00
R1771:Ryr2	UTSW	13	11,745,176 (GRCm38)	critical splice donor site	probably null
R1776:Ryr2	UTSW	13	11,745,176 (GRCm38)	critical splice donor site	probably null
R1783:Ryr2	UTSW	13	11,700,371 (GRCm38)	nonsense	probably null
R1801:Ryr2	UTSW	13	11,595,281 (GRCm38)	missense	probably benign	0.01
R1812:Ryr2	UTSW	13	11,560,586 (GRCm38)	missense	probably damaging	0.97
R1820:Ryr2	UTSW	13	11,587,316 (GRCm38)	missense	probably damaging	0.99
R1835:Ryr2	UTSW	13	11,769,878 (GRCm38)	missense	probably benign	0.06
R1868:Ryr2	UTSW	13	11,731,700 (GRCm38)	missense	probably benign	0.02
R1869:Ryr2	UTSW	13	11,662,075 (GRCm38)	missense	probably damaging	0.98
R1884:Ryr2	UTSW	13	11,738,356 (GRCm38)	missense	probably damaging	0.97
R1892:Ryr2	UTSW	13	11,658,958 (GRCm38)	nonsense	probably null
R1897:Ryr2	UTSW	13	11,750,932 (GRCm38)	missense	probably benign	0.09
R1899:Ryr2	UTSW	13	11,591,336 (GRCm38)	missense	probably benign
R1909:Ryr2	UTSW	13	11,700,349 (GRCm38)	missense	probably damaging	1.00
R1918:Ryr2	UTSW	13	11,556,698 (GRCm38)	missense	possibly damaging	0.91
R1937:Ryr2	UTSW	13	11,668,962 (GRCm38)	missense	probably damaging	1.00
R1943:Ryr2	UTSW	13	11,731,723 (GRCm38)	missense	probably benign	0.10
R1956:Ryr2	UTSW	13	11,681,080 (GRCm38)	missense	probably damaging	1.00
R1983:Ryr2	UTSW	13	11,585,402 (GRCm38)	splice site	probably null
R2018:Ryr2	UTSW	13	11,851,188 (GRCm38)	missense	possibly damaging	0.59
R2019:Ryr2	UTSW	13	11,851,188 (GRCm38)	missense	possibly damaging	0.59
R2060:Ryr2	UTSW	13	11,595,736 (GRCm38)	missense	probably damaging	1.00
R2061:Ryr2	UTSW	13	11,665,878 (GRCm38)	splice site	probably null
R2088:Ryr2	UTSW	13	11,662,229 (GRCm38)	missense	probably benign	0.04
R2089:Ryr2	UTSW	13	11,945,977 (GRCm38)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,945,977 (GRCm38)	missense	probably benign	0.23
R2091:Ryr2	UTSW	13	11,945,977 (GRCm38)	missense	probably benign	0.23
R2127:Ryr2	UTSW	13	11,712,195 (GRCm38)	missense	probably damaging	1.00
R2140:Ryr2	UTSW	13	11,560,607 (GRCm38)	missense	probably damaging	1.00
R2153:Ryr2	UTSW	13	11,577,873 (GRCm38)	missense	possibly damaging	0.86
R2179:Ryr2	UTSW	13	11,705,793 (GRCm38)	nonsense	probably null
R2207:Ryr2	UTSW	13	11,810,937 (GRCm38)	missense	probably damaging	1.00
R2237:Ryr2	UTSW	13	11,662,260 (GRCm38)	missense	probably benign	0.18
R2258:Ryr2	UTSW	13	11,738,216 (GRCm38)	missense	possibly damaging	0.94
R2312:Ryr2	UTSW	13	11,738,242 (GRCm38)	missense	probably damaging	1.00
R2421:Ryr2	UTSW	13	11,591,237 (GRCm38)	missense	probably damaging	0.98
R2438:Ryr2	UTSW	13	11,801,848 (GRCm38)	missense	probably damaging	1.00
R2483:Ryr2	UTSW	13	11,759,703 (GRCm38)	missense	probably damaging	1.00
R2860:Ryr2	UTSW	13	11,593,093 (GRCm38)	missense	probably damaging	0.98
R2861:Ryr2	UTSW	13	11,593,093 (GRCm38)	missense	probably damaging	0.98
R2867:Ryr2	UTSW	13	11,761,349 (GRCm38)	missense	probably damaging	1.00
R2867:Ryr2	UTSW	13	11,761,349 (GRCm38)	missense	probably damaging	1.00
R3618:Ryr2	UTSW	13	11,772,580 (GRCm38)	critical splice acceptor site	probably null
R3876:Ryr2	UTSW	13	11,588,159 (GRCm38)	missense	probably damaging	0.99
R3906:Ryr2	UTSW	13	11,738,209 (GRCm38)	missense	possibly damaging	0.87
R3912:Ryr2	UTSW	13	11,772,427 (GRCm38)	missense	probably damaging	0.99
R4018:Ryr2	UTSW	13	11,918,414 (GRCm38)	missense	probably damaging	1.00
R4114:Ryr2	UTSW	13	11,692,682 (GRCm38)	missense	probably damaging	1.00
R4119:Ryr2	UTSW	13	11,779,267 (GRCm38)	missense	probably benign	0.22
R4127:Ryr2	UTSW	13	11,587,437 (GRCm38)	missense	possibly damaging	0.91
R4222:Ryr2	UTSW	13	11,737,873 (GRCm38)	missense	possibly damaging	0.92
R4233:Ryr2	UTSW	13	11,750,725 (GRCm38)	missense	probably benign	0.20
R4355:Ryr2	UTSW	13	11,649,812 (GRCm38)	missense	probably benign	0.05
R4384:Ryr2	UTSW	13	11,605,233 (GRCm38)	missense	probably damaging	0.99
R4422:Ryr2	UTSW	13	11,717,066 (GRCm38)	nonsense	probably null
R4430:Ryr2	UTSW	13	11,735,527 (GRCm38)	missense	probably damaging	0.98
R4624:Ryr2	UTSW	13	12,106,415 (GRCm38)	missense	possibly damaging	0.47
R4663:Ryr2	UTSW	13	11,749,509 (GRCm38)	missense	possibly damaging	0.47
R4665:Ryr2	UTSW	13	11,750,685 (GRCm38)	splice site	probably null
R4668:Ryr2	UTSW	13	11,593,117 (GRCm38)	missense	probably benign
R4677:Ryr2	UTSW	13	11,706,667 (GRCm38)	missense	probably damaging	0.98
R4679:Ryr2	UTSW	13	11,824,369 (GRCm38)	missense	probably benign	0.34
R4680:Ryr2	UTSW	13	11,595,233 (GRCm38)	missense	probably benign	0.04
R4685:Ryr2	UTSW	13	11,692,646 (GRCm38)	missense	probably damaging	1.00
R4709:Ryr2	UTSW	13	11,716,998 (GRCm38)	missense	probably damaging	1.00
R4731:Ryr2	UTSW	13	11,577,909 (GRCm38)	missense	possibly damaging	0.53
R4732:Ryr2	UTSW	13	11,577,909 (GRCm38)	missense	possibly damaging	0.53
R4733:Ryr2	UTSW	13	11,577,909 (GRCm38)	missense	possibly damaging	0.53
R4734:Ryr2	UTSW	13	11,737,753 (GRCm38)	missense	probably damaging	0.99
R4740:Ryr2	UTSW	13	11,657,047 (GRCm38)	missense	possibly damaging	0.95
R4801:Ryr2	UTSW	13	11,708,227 (GRCm38)	missense	probably damaging	1.00
R4801:Ryr2	UTSW	13	11,687,932 (GRCm38)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,687,932 (GRCm38)	missense	probably damaging	1.00
R4802:Ryr2	UTSW	13	11,708,227 (GRCm38)	missense	probably damaging	1.00
R4804:Ryr2	UTSW	13	11,717,097 (GRCm38)	missense	probably damaging	1.00
R4811:Ryr2	UTSW	13	11,655,698 (GRCm38)	missense	probably damaging	0.97
R4850:Ryr2	UTSW	13	11,745,752 (GRCm38)	missense	probably damaging	1.00
R4850:Ryr2	UTSW	13	11,668,820 (GRCm38)	missense	probably damaging	0.99
R4880:Ryr2	UTSW	13	11,752,218 (GRCm38)	missense	probably damaging	1.00
R4917:Ryr2	UTSW	13	11,594,986 (GRCm38)	missense	probably damaging	0.96
R4918:Ryr2	UTSW	13	11,594,986 (GRCm38)	missense	probably damaging	0.96
R4922:Ryr2	UTSW	13	11,709,963 (GRCm38)	missense	probably damaging	0.99
R4933:Ryr2	UTSW	13	11,945,945 (GRCm38)	missense	probably damaging	0.96
R4950:Ryr2	UTSW	13	11,742,011 (GRCm38)	missense	probably damaging	1.00
R4957:Ryr2	UTSW	13	11,785,080 (GRCm38)	missense	probably damaging	0.97
R4964:Ryr2	UTSW	13	11,833,992 (GRCm38)	missense	probably benign	0.00
R4964:Ryr2	UTSW	13	11,714,611 (GRCm38)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,714,611 (GRCm38)	missense	possibly damaging	0.49
R4966:Ryr2	UTSW	13	11,833,992 (GRCm38)	missense	probably benign	0.00
R4997:Ryr2	UTSW	13	11,595,306 (GRCm38)	missense	probably benign	0.09
R4998:Ryr2	UTSW	13	11,643,895 (GRCm38)	missense	probably damaging	1.00
R5033:Ryr2	UTSW	13	11,587,254 (GRCm38)	missense	possibly damaging	0.93
R5061:Ryr2	UTSW	13	11,635,536 (GRCm38)	missense	possibly damaging	0.74
R5062:Ryr2	UTSW	13	11,700,354 (GRCm38)	missense	probably damaging	0.97
R5088:Ryr2	UTSW	13	11,712,243 (GRCm38)	nonsense	probably null
R5135:Ryr2	UTSW	13	11,662,130 (GRCm38)	missense	probably benign	0.05
R5138:Ryr2	UTSW	13	11,660,289 (GRCm38)	missense	probably damaging	1.00
R5168:Ryr2	UTSW	13	11,752,321 (GRCm38)	missense	probably benign
R5187:Ryr2	UTSW	13	11,772,452 (GRCm38)	missense	probably damaging	0.99
R5197:Ryr2	UTSW	13	11,638,430 (GRCm38)	critical splice donor site	probably null
R5262:Ryr2	UTSW	13	11,772,437 (GRCm38)	missense	probably damaging	0.99
R5325:Ryr2	UTSW	13	11,690,363 (GRCm38)	missense	probably damaging	0.97
R5381:Ryr2	UTSW	13	11,556,658 (GRCm38)	missense	probably damaging	1.00
R5437:Ryr2	UTSW	13	11,655,713 (GRCm38)	missense	probably damaging	1.00
R5477:Ryr2	UTSW	13	11,705,656 (GRCm38)	missense	probably damaging	1.00
R5497:Ryr2	UTSW	13	11,705,701 (GRCm38)	missense	probably null	0.15
R5509:Ryr2	UTSW	13	11,745,601 (GRCm38)	missense	probably damaging	0.98
R5518:Ryr2	UTSW	13	11,687,909 (GRCm38)	missense	probably benign	0.01
R5571:Ryr2	UTSW	13	11,555,448 (GRCm38)	missense	possibly damaging	0.91
R5591:Ryr2	UTSW	13	11,595,014 (GRCm38)	missense	probably benign	0.06
R5619:Ryr2	UTSW	13	11,708,202 (GRCm38)	missense	probably damaging	1.00
R5630:Ryr2	UTSW	13	11,601,805 (GRCm38)	missense	probably damaging	1.00
R5644:Ryr2	UTSW	13	11,595,582 (GRCm38)	missense	probably damaging	0.99
R5667:Ryr2	UTSW	13	11,759,836 (GRCm38)	missense	probably damaging	1.00
R5836:Ryr2	UTSW	13	11,603,732 (GRCm38)	missense	probably damaging	1.00
R5858:Ryr2	UTSW	13	11,560,574 (GRCm38)	missense	probably damaging	0.99
R5934:Ryr2	UTSW	13	11,584,154 (GRCm38)	missense	probably damaging	0.96
R5939:Ryr2	UTSW	13	11,790,332 (GRCm38)	missense	probably damaging	0.99
R5941:Ryr2	UTSW	13	11,687,902 (GRCm38)	missense	probably damaging	1.00
R5945:Ryr2	UTSW	13	11,660,122 (GRCm38)	missense	probably damaging	1.00
R5946:Ryr2	UTSW	13	11,726,953 (GRCm38)	missense	probably damaging	1.00
R5966:Ryr2	UTSW	13	11,662,238 (GRCm38)	nonsense	probably null
R5974:Ryr2	UTSW	13	11,714,511 (GRCm38)	splice site	probably null
R6104:Ryr2	UTSW	13	11,799,825 (GRCm38)	missense	probably damaging	1.00
R6118:Ryr2	UTSW	13	11,792,689 (GRCm38)	missense	possibly damaging	0.69
R6149:Ryr2	UTSW	13	11,669,017 (GRCm38)	missense	probably benign
R6208:Ryr2	UTSW	13	11,895,220 (GRCm38)	missense	probably benign	0.04
R6217:Ryr2	UTSW	13	11,834,078 (GRCm38)	missense	probably damaging	1.00
R6230:Ryr2	UTSW	13	11,660,107 (GRCm38)	missense	probably damaging	0.99
R6279:Ryr2	UTSW	13	11,680,999 (GRCm38)	missense	probably damaging	0.97
R6294:Ryr2	UTSW	13	11,879,496 (GRCm38)	missense	probably damaging	1.00
R6300:Ryr2	UTSW	13	11,680,999 (GRCm38)	missense	probably damaging	0.97
R6350:Ryr2	UTSW	13	11,761,396 (GRCm38)	missense	probably damaging	0.98
R6484:Ryr2	UTSW	13	11,662,383 (GRCm38)	missense	possibly damaging	0.90
R6489:Ryr2	UTSW	13	11,834,007 (GRCm38)	missense	probably benign	0.29
R6548:Ryr2	UTSW	13	11,668,821 (GRCm38)	missense	probably damaging	1.00
R6591:Ryr2	UTSW	13	11,594,723 (GRCm38)	missense	probably benign	0.01
R6623:Ryr2	UTSW	13	11,710,065 (GRCm38)	missense	probably damaging	1.00
R6649:Ryr2	UTSW	13	11,595,643 (GRCm38)	missense	probably damaging	0.99
R6691:Ryr2	UTSW	13	11,594,723 (GRCm38)	missense	probably benign	0.01
R6770:Ryr2	UTSW	13	11,738,462 (GRCm38)	missense	probably damaging	1.00
R6802:Ryr2	UTSW	13	11,686,966 (GRCm38)	missense	probably damaging	1.00
R6809:Ryr2	UTSW	13	11,726,930 (GRCm38)	missense	probably damaging	1.00
R6893:Ryr2	UTSW	13	11,829,654 (GRCm38)	missense	possibly damaging	0.75
R6911:Ryr2	UTSW	13	11,827,559 (GRCm38)	missense	possibly damaging	0.50
R6915:Ryr2	UTSW	13	11,745,601 (GRCm38)	missense	probably damaging	1.00
R6943:Ryr2	UTSW	13	11,566,948 (GRCm38)	missense	possibly damaging	0.92
R6960:Ryr2	UTSW	13	11,801,243 (GRCm38)	missense	probably benign	0.28
R6997:Ryr2	UTSW	13	11,654,380 (GRCm38)	missense	possibly damaging	0.88
R6998:Ryr2	UTSW	13	11,712,166 (GRCm38)	missense	probably damaging	0.99
R7001:Ryr2	UTSW	13	11,794,605 (GRCm38)	missense	probably damaging	0.98
R7047:Ryr2	UTSW	13	11,824,400 (GRCm38)	missense	possibly damaging	0.64
R7089:Ryr2	UTSW	13	11,649,776 (GRCm38)	missense	probably benign	0.10
R7125:Ryr2	UTSW	13	11,669,987 (GRCm38)	missense	probably damaging	0.99
R7127:Ryr2	UTSW	13	11,655,713 (GRCm38)	missense	probably damaging	1.00
R7131:Ryr2	UTSW	13	11,668,811 (GRCm38)	critical splice donor site	probably null
R7131:Ryr2	UTSW	13	11,640,327 (GRCm38)	missense	possibly damaging	0.63
R7159:Ryr2	UTSW	13	11,810,908 (GRCm38)	missense	probably damaging	0.99
R7174:Ryr2	UTSW	13	11,801,177 (GRCm38)	missense	possibly damaging	0.81
R7180:Ryr2	UTSW	13	11,686,978 (GRCm38)	missense	probably damaging	1.00
R7182:Ryr2	UTSW	13	11,759,757 (GRCm38)	missense	probably benign
R7189:Ryr2	UTSW	13	11,883,123 (GRCm38)	missense	probably damaging	1.00
R7241:Ryr2	UTSW	13	11,665,913 (GRCm38)	missense	possibly damaging	0.71
R7244:Ryr2	UTSW	13	11,597,146 (GRCm38)	missense	probably damaging	1.00
R7326:Ryr2	UTSW	13	11,738,194 (GRCm38)	missense	possibly damaging	0.95
R7331:Ryr2	UTSW	13	11,745,631 (GRCm38)	missense	probably benign
R7365:Ryr2	UTSW	13	11,640,275 (GRCm38)	missense	probably damaging	0.99
R7372:Ryr2	UTSW	13	11,680,999 (GRCm38)	missense	probably damaging	0.97
R7395:Ryr2	UTSW	13	11,785,111 (GRCm38)	missense	probably damaging	0.98
R7404:Ryr2	UTSW	13	11,735,620 (GRCm38)	missense	probably damaging	0.97
R7417:Ryr2	UTSW	13	11,556,748 (GRCm38)	splice site	probably null
R7425:Ryr2	UTSW	13	11,705,644 (GRCm38)	missense	probably benign	0.20
R7444:Ryr2	UTSW	13	11,555,463 (GRCm38)	missense	probably benign	0.25
R7456:Ryr2	UTSW	13	11,752,282 (GRCm38)	missense	probably benign
R7460:Ryr2	UTSW	13	11,705,710 (GRCm38)	missense	probably benign	0.10
R7474:Ryr2	UTSW	13	11,594,876 (GRCm38)	missense	probably benign	0.04
R7543:Ryr2	UTSW	13	11,638,431 (GRCm38)	critical splice donor site	probably null
R7549:Ryr2	UTSW	13	11,737,985 (GRCm38)	missense	probably benign	0.15
R7558:Ryr2	UTSW	13	11,799,825 (GRCm38)	missense	probably damaging	1.00
R7565:Ryr2	UTSW	13	11,560,653 (GRCm38)	missense	possibly damaging	0.84
R7627:Ryr2	UTSW	13	11,761,327 (GRCm38)	missense	possibly damaging	0.65
R7698:Ryr2	UTSW	13	11,761,315 (GRCm38)	missense	possibly damaging	0.94
R7702:Ryr2	UTSW	13	11,690,333 (GRCm38)	missense	probably damaging	0.99
R7719:Ryr2	UTSW	13	11,730,343 (GRCm38)	missense	possibly damaging	0.94
R7772:Ryr2	UTSW	13	11,751,011 (GRCm38)	missense	probably benign
R7797:Ryr2	UTSW	13	11,801,180 (GRCm38)	missense	probably damaging	0.99
R7829:Ryr2	UTSW	13	11,827,607 (GRCm38)	missense	possibly damaging	0.81
R7855:Ryr2	UTSW	13	11,706,623 (GRCm38)	nonsense	probably null
R7872:Ryr2	UTSW	13	11,595,724 (GRCm38)	missense	probably damaging	1.00
R7908:Ryr2	UTSW	13	11,792,748 (GRCm38)	missense	probably benign	0.01
R7929:Ryr2	UTSW	13	11,594,794 (GRCm38)	missense	probably damaging	1.00
R7929:Ryr2	UTSW	13	11,690,295 (GRCm38)	nonsense	probably null
R7952:Ryr2	UTSW	13	11,646,427 (GRCm38)	splice site	probably null
R8008:Ryr2	UTSW	13	11,657,094 (GRCm38)	missense	probably benign	0.30
R8011:Ryr2	UTSW	13	11,588,140 (GRCm38)	critical splice donor site	probably null
R8097:Ryr2	UTSW	13	11,945,995 (GRCm38)	missense	probably damaging	0.98
R8133:Ryr2	UTSW	13	11,603,698 (GRCm38)	missense	probably damaging	1.00
R8253:Ryr2	UTSW	13	11,827,553 (GRCm38)	missense	possibly damaging	0.94
R8278:Ryr2	UTSW	13	11,595,506 (GRCm38)	nonsense	probably null
R8351:Ryr2	UTSW	13	11,799,832 (GRCm38)	missense	probably damaging	0.98
R8401:Ryr2	UTSW	13	11,668,935 (GRCm38)	missense	possibly damaging	0.95
R8403:Ryr2	UTSW	13	11,684,478 (GRCm38)	missense	possibly damaging	0.95
R8431:Ryr2	UTSW	13	11,659,008 (GRCm38)	missense	probably benign	0.00
R8509:Ryr2	UTSW	13	11,577,778 (GRCm38)	critical splice donor site	probably null
R8551:Ryr2	UTSW	13	11,560,593 (GRCm38)	missense	possibly damaging	0.93
R8684:Ryr2	UTSW	13	11,687,989 (GRCm38)	missense	probably damaging	0.99
R8735:Ryr2	UTSW	13	11,686,947 (GRCm38)	missense	probably damaging	0.97
R8766:Ryr2	UTSW	13	11,668,969 (GRCm38)	missense	probably damaging	0.97
R8817:Ryr2	UTSW	13	11,735,623 (GRCm38)	missense	possibly damaging	0.95
R8827:Ryr2	UTSW	13	11,558,048 (GRCm38)	missense	possibly damaging	0.80
R8884:Ryr2	UTSW	13	11,779,266 (GRCm38)	missense	probably benign	0.19
R8889:Ryr2	UTSW	13	11,785,104 (GRCm38)	missense	probably damaging	0.99
R8891:Ryr2	UTSW	13	11,799,882 (GRCm38)	missense	probably damaging	1.00
R8979:Ryr2	UTSW	13	11,595,038 (GRCm38)	missense	probably benign	0.00
R9013:Ryr2	UTSW	13	11,603,732 (GRCm38)	missense	probably damaging	0.98
R9040:Ryr2	UTSW	13	11,594,786 (GRCm38)	missense	probably damaging	0.97
R9044:Ryr2	UTSW	13	11,738,103 (GRCm38)	nonsense	probably null
R9056:Ryr2	UTSW	13	11,595,931 (GRCm38)	missense	possibly damaging	0.94
R9084:Ryr2	UTSW	13	11,601,838 (GRCm38)	missense	probably damaging	1.00
R9113:Ryr2	UTSW	13	11,603,855 (GRCm38)	intron	probably benign
R9116:Ryr2	UTSW	13	11,572,299 (GRCm38)	missense	possibly damaging	0.93
R9125:Ryr2	UTSW	13	11,654,406 (GRCm38)	missense	probably benign	0.28
R9148:Ryr2	UTSW	13	11,885,538 (GRCm38)	missense	probably benign	0.02
R9210:Ryr2	UTSW	13	11,829,674 (GRCm38)	missense	probably damaging	0.99
R9212:Ryr2	UTSW	13	11,829,674 (GRCm38)	missense	probably damaging	0.99
R9233:Ryr2	UTSW	13	11,595,886 (GRCm38)	missense	possibly damaging	0.77
R9254:Ryr2	UTSW	13	11,883,116 (GRCm38)	missense	probably damaging	1.00
R9262:Ryr2	UTSW	13	11,750,968 (GRCm38)	missense	probably damaging	0.97
R9275:Ryr2	UTSW	13	11,883,090 (GRCm38)	missense	probably benign	0.10
R9278:Ryr2	UTSW	13	11,883,090 (GRCm38)	missense	probably benign	0.10
R9309:Ryr2	UTSW	13	11,706,692 (GRCm38)	missense	probably damaging	0.99
R9379:Ryr2	UTSW	13	11,883,116 (GRCm38)	missense	probably damaging	1.00
R9409:Ryr2	UTSW	13	11,681,087 (GRCm38)	missense	probably damaging	0.99
R9429:Ryr2	UTSW	13	11,794,573 (GRCm38)	missense	probably damaging	0.97
R9445:Ryr2	UTSW	13	11,772,577 (GRCm38)	missense	probably damaging	1.00
R9464:Ryr2	UTSW	13	11,737,794 (GRCm38)	missense	probably benign	0.00
R9467:Ryr2	UTSW	13	11,556,604 (GRCm38)	missense	possibly damaging	0.70
R9546:Ryr2	UTSW	13	11,587,215 (GRCm38)	critical splice donor site	probably null
R9562:Ryr2	UTSW	13	11,745,218 (GRCm38)	missense	probably damaging	1.00
R9609:Ryr2	UTSW	13	11,668,962 (GRCm38)	missense	probably damaging	1.00
R9704:Ryr2	UTSW	13	11,722,760 (GRCm38)	missense	probably damaging	1.00
R9764:Ryr2	UTSW	13	11,687,049 (GRCm38)	missense	possibly damaging	0.67
R9772:Ryr2	UTSW	13	11,594,899 (GRCm38)	missense	probably benign	0.13
R9776:Ryr2	UTSW	13	11,692,713 (GRCm38)	missense	probably damaging	0.98
S24628:Ryr2	UTSW	13	11,869,156 (GRCm38)	missense	probably damaging	0.97
X0019:Ryr2	UTSW	13	11,703,501 (GRCm38)	missense	probably benign	0.04
Z1176:Ryr2	UTSW	13	11,643,803 (GRCm38)	critical splice donor site	probably null
Z1176:Ryr2	UTSW	13	11,598,611 (GRCm38)	critical splice acceptor site	probably null
Z1176:Ryr2	UTSW	13	11,794,549 (GRCm38)	nonsense	probably null
Z1177:Ryr2	UTSW	13	11,750,873 (GRCm38)	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TAGACCATCAGCCTTGGGTG -3'
(R):5'- GCTGGTGACTCCTTAAGTATGGAC -3'

Sequencing Primer
(F):5'- ATCAGCCTTGGGTGGACAC -3'
(R):5'- ACTCCTTAAGTATGGACTTTTGGC -3'

Posted On

2016-12-15