Incidental Mutation 'R5775:Cyp11b2'
ID448751
Institutional Source Beutler Lab
Gene Symbol Cyp11b2
Ensembl Gene ENSMUSG00000022589
Gene Namecytochrome P450, family 11, subfamily b, polypeptide 2
SynonymsCyp11b-2, Cyp11b, aldosterone synthase, steroid-11-beta-hydroxylase
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74851010-74856318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74853478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 264 (V264A)
Ref Sequence ENSEMBL: ENSMUSP00000131503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167634]
Predicted Effect probably benign
Transcript: ENSMUST00000167634
AA Change: V264A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131503
Gene: ENSMUSG00000022589
AA Change: V264A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:p450 44 498 1e-115 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some postnatal lethality, altered blood chemistry, hypotension, and abnormal adrenal cortex morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Cyp11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Cyp11b2 APN 15 74853515 missense probably benign 0.00
IGL02058:Cyp11b2 APN 15 74853189 missense probably benign 0.30
IGL02419:Cyp11b2 APN 15 74851055 missense probably damaging 1.00
IGL03094:Cyp11b2 APN 15 74853037 critical splice donor site probably null
IGL03237:Cyp11b2 APN 15 74851065 missense probably benign 0.00
Spargel UTSW 15 74851432 missense probably damaging 1.00
stickfigure UTSW 15 74851570 missense possibly damaging 0.46
Stringbean UTSW 15 74853130 missense probably damaging 1.00
veronica UTSW 15 74853991 missense probably damaging 1.00
PIT4243001:Cyp11b2 UTSW 15 74851453 missense probably damaging 1.00
R0522:Cyp11b2 UTSW 15 74851684 splice site probably benign
R0674:Cyp11b2 UTSW 15 74855544 missense probably damaging 1.00
R0837:Cyp11b2 UTSW 15 74853641 missense probably damaging 1.00
R1386:Cyp11b2 UTSW 15 74851775 critical splice acceptor site probably null
R1423:Cyp11b2 UTSW 15 74853130 missense probably damaging 1.00
R1550:Cyp11b2 UTSW 15 74853593 missense probably benign 0.07
R3437:Cyp11b2 UTSW 15 74855449 missense probably benign
R3693:Cyp11b2 UTSW 15 74856008 missense probably benign 0.00
R4447:Cyp11b2 UTSW 15 74855563 missense probably benign 0.00
R4870:Cyp11b2 UTSW 15 74853146 missense probably benign 0.00
R4947:Cyp11b2 UTSW 15 74851570 missense possibly damaging 0.46
R4968:Cyp11b2 UTSW 15 74854005 splice site probably null
R5115:Cyp11b2 UTSW 15 74855428 critical splice donor site probably null
R6738:Cyp11b2 UTSW 15 74853514 missense possibly damaging 0.65
R6841:Cyp11b2 UTSW 15 74855491 missense probably benign 0.00
R6942:Cyp11b2 UTSW 15 74856245 start gained probably benign
R6997:Cyp11b2 UTSW 15 74851432 missense probably damaging 1.00
R7094:Cyp11b2 UTSW 15 74853658 missense possibly damaging 0.94
R7096:Cyp11b2 UTSW 15 74855988 missense probably damaging 0.98
R7275:Cyp11b2 UTSW 15 74853991 missense probably damaging 1.00
R7456:Cyp11b2 UTSW 15 74853530 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTCCTTTCAGTCATAGGCCTG -3'
(R):5'- CGCCTTAGCTCAGGATTACC -3'

Sequencing Primer
(F):5'- CTTTCAGTCATAGGCCTGGTAGGAAC -3'
(R):5'- GGATTACCATTCTTTCTGCAGCCAG -3'
Posted On2016-12-15