Incidental Mutation 'R5775:Foxh1'
ID 448752
Institutional Source Beutler Lab
Gene Symbol Foxh1
Ensembl Gene ENSMUSG00000033837
Gene Name forkhead box H1
Synonyms Fast2
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5775 (G1)
Quality Score 154
Status Validated
Chromosome 15
Chromosomal Location 76668225-76669948 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 76669849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 8 (A8V)
Ref Sequence ENSEMBL: ENSMUSP00000036591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004294] [ENSMUST00000037551] [ENSMUST00000037824] [ENSMUST00000135388] [ENSMUST00000230451] [ENSMUST00000230964]
AlphaFold O88621
Predicted Effect probably benign
Transcript: ENSMUST00000004294
SMART Domains Protein: ENSMUSP00000004294
Gene: ENSMUSG00000004187

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 36 45 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
coiled coil region 195 235 N/A INTRINSIC
coiled coil region 274 345 N/A INTRINSIC
KISc 407 740 3.21e-141 SMART
low complexity region 745 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037551
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037824
AA Change: A8V

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036591
Gene: ENSMUSG00000033837
AA Change: A8V

DomainStartEndE-ValueType
FH 62 152 2.71e-34 SMART
low complexity region 183 194 N/A INTRINSIC
low complexity region 331 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230207
Predicted Effect probably benign
Transcript: ENSMUST00000230451
Predicted Effect probably benign
Transcript: ENSMUST00000230964
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FOXH1 encodes a human homolog of Xenopus forkhead activin signal transducer-1. FOXH1 protein binds SMAD2 and activates an activin response element via binding the DNA motif TGT(G/T)(T/G)ATT. [provided by RefSeq, Jul 2008]
PHENOTYPE: Conditional knockout of this gene in the lateral plate mesoderm results in death within a few days after birth. Mutant animals exhibit right isomerism affecting the heart, lungs, and stomach. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Prrc2a T C 17: 35,158,487 D565G unknown Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Foxh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Foxh1 APN 15 76668920 missense probably damaging 1.00
R0112:Foxh1 UTSW 15 76669010 missense probably benign 0.00
R0126:Foxh1 UTSW 15 76669254 missense probably damaging 1.00
R2266:Foxh1 UTSW 15 76668620 missense probably benign 0.00
R5223:Foxh1 UTSW 15 76668729 splice site probably null
R6666:Foxh1 UTSW 15 76668413 missense probably damaging 1.00
R7528:Foxh1 UTSW 15 76669311 missense probably benign 0.03
R8095:Foxh1 UTSW 15 76669008 nonsense probably null
R8936:Foxh1 UTSW 15 76668519 unclassified probably benign
R9287:Foxh1 UTSW 15 76668926 missense probably damaging 0.99
R9429:Foxh1 UTSW 15 76669242 missense probably null 0.16
Z1177:Foxh1 UTSW 15 76669021 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATGGCCAAGTAGGTGTAGG -3'
(R):5'- CAACCTGGGAGTGGAGATTG -3'

Sequencing Primer
(F):5'- AAAGAGACTCTGCCTCTG -3'
(R):5'- AGATTGATTTCGGGGGCCACC -3'
Posted On 2016-12-15