Incidental Mutation 'R5775:Prrc2a'
ID448756
Institutional Source Beutler Lab
Gene Symbol Prrc2a
Ensembl Gene ENSMUSG00000024393
Gene Nameproline-rich coiled-coil 2A
SynonymsD17H6S51E, G2, 3110039B05Rik, Bat-2, Bat2, Wbp12
MMRRC Submission 043374-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R5775 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35149076-35164897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35158487 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 565 (D565G)
Ref Sequence ENSEMBL: ENSMUSP00000133550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025253] [ENSMUST00000174805]
Predicted Effect unknown
Transcript: ENSMUST00000025253
AA Change: D620G
SMART Domains Protein: ENSMUSP00000025253
Gene: ENSMUSG00000024393
AA Change: D620G

DomainStartEndE-ValueType
Pfam:BAT2_N 1 189 1.2e-70 PFAM
low complexity region 243 276 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
low complexity region 396 413 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
coiled coil region 455 494 N/A INTRINSIC
low complexity region 504 523 N/A INTRINSIC
low complexity region 527 566 N/A INTRINSIC
low complexity region 593 618 N/A INTRINSIC
low complexity region 643 684 N/A INTRINSIC
low complexity region 687 709 N/A INTRINSIC
low complexity region 711 717 N/A INTRINSIC
low complexity region 755 768 N/A INTRINSIC
low complexity region 826 833 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
low complexity region 882 894 N/A INTRINSIC
low complexity region 902 924 N/A INTRINSIC
low complexity region 944 966 N/A INTRINSIC
low complexity region 1032 1070 N/A INTRINSIC
low complexity region 1129 1149 N/A INTRINSIC
low complexity region 1162 1179 N/A INTRINSIC
low complexity region 1190 1211 N/A INTRINSIC
low complexity region 1234 1242 N/A INTRINSIC
low complexity region 1285 1300 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1394 1424 N/A INTRINSIC
low complexity region 1430 1456 N/A INTRINSIC
low complexity region 1488 1511 N/A INTRINSIC
low complexity region 1553 1565 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
internal_repeat_1 1810 1860 5.56e-5 PROSPERO
low complexity region 1879 1895 N/A INTRINSIC
internal_repeat_1 1924 1983 5.56e-5 PROSPERO
low complexity region 1995 2017 N/A INTRINSIC
low complexity region 2019 2041 N/A INTRINSIC
low complexity region 2070 2086 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172929
Predicted Effect unknown
Transcript: ENSMUST00000174805
AA Change: D565G
SMART Domains Protein: ENSMUSP00000133550
Gene: ENSMUSG00000024393
AA Change: D565G

DomainStartEndE-ValueType
Pfam:BAT2_N 1 137 6.6e-53 PFAM
low complexity region 188 221 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
coiled coil region 400 439 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 472 511 N/A INTRINSIC
low complexity region 538 563 N/A INTRINSIC
low complexity region 588 629 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 656 662 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
low complexity region 771 778 N/A INTRINSIC
low complexity region 806 816 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 847 869 N/A INTRINSIC
low complexity region 889 911 N/A INTRINSIC
low complexity region 977 1015 N/A INTRINSIC
low complexity region 1074 1094 N/A INTRINSIC
low complexity region 1107 1124 N/A INTRINSIC
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1179 1187 N/A INTRINSIC
low complexity region 1230 1245 N/A INTRINSIC
low complexity region 1291 1305 N/A INTRINSIC
low complexity region 1339 1369 N/A INTRINSIC
low complexity region 1375 1401 N/A INTRINSIC
low complexity region 1433 1456 N/A INTRINSIC
low complexity region 1498 1510 N/A INTRINSIC
low complexity region 1638 1658 N/A INTRINSIC
internal_repeat_1 1755 1804 3.99e-5 PROSPERO
low complexity region 1823 1839 N/A INTRINSIC
internal_repeat_1 1868 1927 3.99e-5 PROSPERO
low complexity region 1939 1961 N/A INTRINSIC
low complexity region 1963 1985 N/A INTRINSIC
low complexity region 2014 2030 N/A INTRINSIC
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for TNF alpha and TNF beta. These genes are all within the human major histocompatibility complex class III region. This gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. This gene is also a candidate gene for the development of rheumatoid arthritis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6a A G 12: 113,546,266 D753G possibly damaging Het
AF067061 T A 13: 120,263,939 C46* probably null Het
Arpc2 T A 1: 74,255,949 probably null Het
Atxn2 C T 5: 121,813,449 T619M probably damaging Het
Cacna1s T C 1: 136,108,122 Y1120H probably damaging Het
Calm5 T C 13: 3,854,435 L20S probably damaging Het
Carmil1 T C 13: 24,276,537 I20V probably benign Het
Cd177 T C 7: 24,752,268 E441G probably damaging Het
Cd63 T A 10: 128,910,430 C9S probably damaging Het
Cep250 A C 2: 155,969,374 D380A possibly damaging Het
Col5a3 G T 9: 20,801,072 P509Q unknown Het
Cyp11b2 A G 15: 74,853,478 V264A probably benign Het
Dennd6a T A 14: 26,619,373 L214* probably null Het
Dna2 A G 10: 62,949,242 N46S possibly damaging Het
Elovl1 G A 4: 118,430,897 V77I probably benign Het
Eml1 A T 12: 108,506,554 Y207F probably damaging Het
Epha6 C T 16: 59,818,994 R839Q possibly damaging Het
Erlec1 A T 11: 30,943,848 S105T probably benign Het
Esp3 T A 17: 40,633,577 S37T possibly damaging Het
Foxh1 G A 15: 76,669,849 A8V probably benign Het
Fut1 A C 7: 45,619,462 D280A probably damaging Het
Gm13998 G T 2: 119,878,411 noncoding transcript Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2afz T C 3: 137,865,619 Y61H probably damaging Het
Kcns1 T C 2: 164,164,766 I426V probably damaging Het
Kdm4c T G 4: 74,359,431 V774G probably damaging Het
Mrc2 G A 11: 105,337,813 V673I probably benign Het
Mtnr1b G A 9: 15,862,872 A297V possibly damaging Het
Olfr1173 A T 2: 88,274,701 M116K probably damaging Het
Olfr889 A T 9: 38,116,127 E110D probably damaging Het
Osbpl5 A T 7: 143,704,529 V346D probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pigo T C 4: 43,023,475 D233G probably damaging Het
Pmm1 A T 15: 81,951,955 I152N probably benign Het
Pot1a A T 6: 25,757,298 probably null Het
Ppp1r12b G T 1: 134,876,042 L460I probably benign Het
Psd C A 19: 46,314,772 E724* probably null Het
Rasa2 C T 9: 96,577,468 probably null Het
Rsbn1 A T 3: 103,962,572 Q783L possibly damaging Het
Ryr2 T C 13: 11,769,962 Y1035C probably damaging Het
Sec24d C T 3: 123,290,460 A96V probably benign Het
Sec61a2 A T 2: 5,882,774 probably null Het
Sec62 A G 3: 30,793,287 probably benign Het
Tmem132b T A 5: 125,638,330 probably null Het
Tnip3 A G 6: 65,614,757 S247G probably benign Het
Traf3 A G 12: 111,252,728 K263R possibly damaging Het
Tubgcp3 A T 8: 12,625,056 I713N probably damaging Het
Unc5c A G 3: 141,828,520 E860G probably damaging Het
Usp44 A G 10: 93,845,978 S97G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps37a A G 8: 40,529,119 H109R probably damaging Het
Wfikkn2 G T 11: 94,238,288 D342E probably benign Het
Zfp354b A T 11: 50,922,820 F426Y probably benign Het
Zfp462 C A 4: 55,010,590 T852N probably damaging Het
Zfp987 T G 4: 146,124,935 S312R probably benign Het
Other mutations in Prrc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Prrc2a APN 17 35154983 missense probably damaging 0.99
IGL01083:Prrc2a APN 17 35156201 missense possibly damaging 0.93
IGL01394:Prrc2a APN 17 35153104 missense probably benign 0.00
IGL01618:Prrc2a APN 17 35149553 missense probably damaging 1.00
IGL01700:Prrc2a APN 17 35150667 missense possibly damaging 0.93
IGL01937:Prrc2a APN 17 35155591 missense possibly damaging 0.63
IGL02407:Prrc2a APN 17 35160504 missense unknown
IGL02683:Prrc2a APN 17 35155993 missense probably benign 0.00
R0145:Prrc2a UTSW 17 35155820 missense probably benign
R0309:Prrc2a UTSW 17 35150915 splice site probably benign
R0441:Prrc2a UTSW 17 35149688 splice site probably benign
R0617:Prrc2a UTSW 17 35153560 missense probably damaging 1.00
R0645:Prrc2a UTSW 17 35156332 missense probably damaging 0.99
R1351:Prrc2a UTSW 17 35157887 missense possibly damaging 0.86
R1432:Prrc2a UTSW 17 35153912 splice site probably benign
R1490:Prrc2a UTSW 17 35153254 missense probably benign
R1643:Prrc2a UTSW 17 35156954 missense probably damaging 0.99
R1734:Prrc2a UTSW 17 35150707 missense possibly damaging 0.93
R1869:Prrc2a UTSW 17 35153308 missense possibly damaging 0.93
R1937:Prrc2a UTSW 17 35157908 missense probably damaging 0.99
R1995:Prrc2a UTSW 17 35157429 missense probably damaging 0.98
R2257:Prrc2a UTSW 17 35161068 missense unknown
R2270:Prrc2a UTSW 17 35149536 missense possibly damaging 0.91
R3940:Prrc2a UTSW 17 35157498 missense possibly damaging 0.86
R3973:Prrc2a UTSW 17 35157932 missense probably damaging 0.99
R4569:Prrc2a UTSW 17 35158497 missense unknown
R4655:Prrc2a UTSW 17 35155614 missense probably benign 0.00
R4792:Prrc2a UTSW 17 35156487 missense probably damaging 0.96
R4797:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R4798:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R4799:Prrc2a UTSW 17 35150042 missense probably damaging 1.00
R5004:Prrc2a UTSW 17 35149998 missense probably benign 0.11
R5129:Prrc2a UTSW 17 35160178 missense unknown
R5155:Prrc2a UTSW 17 35160091 splice site probably null
R5210:Prrc2a UTSW 17 35153620 missense probably damaging 0.99
R5308:Prrc2a UTSW 17 35161047 missense unknown
R5474:Prrc2a UTSW 17 35159213 missense unknown
R5934:Prrc2a UTSW 17 35150084 missense probably damaging 0.98
R6057:Prrc2a UTSW 17 35152740 missense probably benign 0.00
R6291:Prrc2a UTSW 17 35154933 missense probably damaging 0.99
R6535:Prrc2a UTSW 17 35162265 missense unknown
R6622:Prrc2a UTSW 17 35155420 missense probably damaging 0.98
R6887:Prrc2a UTSW 17 35155675 missense probably damaging 0.99
R6971:Prrc2a UTSW 17 35159501 splice site probably null
R7026:Prrc2a UTSW 17 35161827 missense unknown
R7059:Prrc2a UTSW 17 35157388 missense probably damaging 0.99
R7489:Prrc2a UTSW 17 35162354 missense unknown
R7502:Prrc2a UTSW 17 35162310 missense unknown
R7951:Prrc2a UTSW 17 35160501 missense unknown
R8061:Prrc2a UTSW 17 35161186 splice site probably benign
R8324:Prrc2a UTSW 17 35156984 missense possibly damaging 0.46
X0011:Prrc2a UTSW 17 35155898 missense probably damaging 0.99
Z1177:Prrc2a UTSW 17 35154815 missense probably damaging 0.98
Z1177:Prrc2a UTSW 17 35155700 missense probably damaging 0.99
Z1177:Prrc2a UTSW 17 35161360 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGTGCTACAACAGAAAGACG -3'
(R):5'- AGGATGGCCACTTATTCAGTTCG -3'

Sequencing Primer
(F):5'- GACGAACCCAGGCCTGAAG -3'
(R):5'- GGCCACTTATTCAGTTCGTATTTTG -3'
Posted On2016-12-15