Incidental Mutation 'R5802:Cnga3'
ID448760
Institutional Source Beutler Lab
Gene Symbol Cnga3
Ensembl Gene ENSMUSG00000026114
Gene Namecyclic nucleotide gated channel alpha 3
SynonymsCNG3
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37214434-37263384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37260925 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 280 (F280S)
Ref Sequence ENSEMBL: ENSMUSP00000142175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027288] [ENSMUST00000194195] [ENSMUST00000195272]
Predicted Effect probably damaging
Transcript: ENSMUST00000027288
AA Change: F242S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027288
Gene: ENSMUSG00000026114
AA Change: F242S

DomainStartEndE-ValueType
Pfam:Ion_trans 109 351 1.3e-30 PFAM
cNMP 423 547 2.5e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000194195
AA Change: F242S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142075
Gene: ENSMUSG00000026114
AA Change: F242S

DomainStartEndE-ValueType
Pfam:Ion_trans 146 340 1.3e-15 PFAM
cNMP 423 547 2.4e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000195272
AA Change: F280S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142175
Gene: ENSMUSG00000026114
AA Change: F280S

DomainStartEndE-ValueType
Pfam:Ion_trans 184 378 1.5e-15 PFAM
cNMP 461 585 2.4e-28 SMART
PDB:3SWY|C 605 648 3e-14 PDB
Meta Mutation Damage Score 0.9270 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclic nucleotide-gated cation channel protein family which is required for normal vision and olfactory signal transduction. Mutations in this gene are associated with achromatopsia (rod monochromacy) and color blindness. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals experience progressive loss of cone photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Cnga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Cnga3 APN 1 37260793 missense possibly damaging 0.89
IGL01677:Cnga3 APN 1 37244918 nonsense probably null
IGL02475:Cnga3 APN 1 37257991 critical splice acceptor site probably null
IGL03145:Cnga3 APN 1 37261674 missense probably damaging 1.00
R1557:Cnga3 UTSW 1 37260985 missense probably damaging 1.00
R1622:Cnga3 UTSW 1 37244828 splice site probably benign
R1678:Cnga3 UTSW 1 37261498 missense possibly damaging 0.94
R1938:Cnga3 UTSW 1 37261873 missense possibly damaging 0.95
R2968:Cnga3 UTSW 1 37261078 missense probably damaging 1.00
R2969:Cnga3 UTSW 1 37261078 missense probably damaging 1.00
R3406:Cnga3 UTSW 1 37262065 missense probably benign 0.00
R3694:Cnga3 UTSW 1 37261740 missense probably damaging 1.00
R4079:Cnga3 UTSW 1 37241865 missense possibly damaging 0.70
R4850:Cnga3 UTSW 1 37258006 nonsense probably null
R4907:Cnga3 UTSW 1 37241942 critical splice donor site probably null
R6135:Cnga3 UTSW 1 37232237 start gained probably benign
R6586:Cnga3 UTSW 1 37261278 missense probably damaging 0.99
R6997:Cnga3 UTSW 1 37244884 missense probably benign 0.34
R7630:Cnga3 UTSW 1 37258046 missense probably damaging 1.00
R7799:Cnga3 UTSW 1 37261771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACACAAAGACCTTGCACTTC -3'
(R):5'- ACTCTTCATCTTTCACGGGG -3'

Sequencing Primer
(F):5'- GCACTTCAAGCTGGACATCCTG -3'
(R):5'- CCAATGGTGGTCAGGGTCAG -3'
Posted On2016-12-15