Incidental Mutation 'R5802:Dnajc1'
ID448763
Institutional Source Beutler Lab
Gene Symbol Dnajc1
Ensembl Gene ENSMUSG00000026740
Gene NameDnaJ heat shock protein family (Hsp40) member C1
Synonyms4733401K02Rik, MTJ1, Dnajl1, D230036H06Rik, ERdj1
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location18195654-18392830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18284739 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 286 (Y286H)
Ref Sequence ENSEMBL: ENSMUSP00000126321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028072] [ENSMUST00000091418] [ENSMUST00000166495]
Predicted Effect probably benign
Transcript: ENSMUST00000028072
SMART Domains Protein: ENSMUSP00000028072
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 104 5.4e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091418
AA Change: Y286H

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088980
Gene: ENSMUSG00000026740
AA Change: Y286H

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163130
SMART Domains Protein: ENSMUSP00000129176
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
DnaJ 34 78 5.4e-10 SMART
Predicted Effect silent
Transcript: ENSMUST00000164835
Predicted Effect probably benign
Transcript: ENSMUST00000166495
AA Change: Y286H

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126321
Gene: ENSMUSG00000026740
AA Change: Y286H

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168723
AA Change: Y90H
SMART Domains Protein: ENSMUSP00000126716
Gene: ENSMUSG00000026740
AA Change: Y90H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
SANT 129 180 2.06e-6 SMART
low complexity region 221 239 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
SANT 296 348 3.56e-10 SMART
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a DNAJ-like heat shock protein that binds the molecular chaperone BiP. In addition, the encoded protein contains two SANT domains that have been shown to bind serpin alpha1-antichymotrypsin and inter-alpha trypsin inhibitor heavy chain 4. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Dnajc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dnajc1 APN 2 18308902 missense possibly damaging 0.80
IGL01301:Dnajc1 APN 2 18308834 missense probably damaging 0.99
IGL02080:Dnajc1 APN 2 18316348 intron probably benign
IGL03058:Dnajc1 APN 2 18217321 missense possibly damaging 0.90
ANU18:Dnajc1 UTSW 2 18308834 missense probably damaging 0.99
R0537:Dnajc1 UTSW 2 18307956 missense possibly damaging 0.63
R0630:Dnajc1 UTSW 2 18231801 missense probably damaging 1.00
R1187:Dnajc1 UTSW 2 18284709 missense probably benign 0.01
R1511:Dnajc1 UTSW 2 18222727 missense possibly damaging 0.88
R1844:Dnajc1 UTSW 2 18294027 nonsense probably null
R1848:Dnajc1 UTSW 2 18219713 missense probably damaging 1.00
R2174:Dnajc1 UTSW 2 18307951 missense probably damaging 0.99
R2199:Dnajc1 UTSW 2 18308899 missense probably damaging 1.00
R2211:Dnajc1 UTSW 2 18392475 missense probably damaging 0.99
R2471:Dnajc1 UTSW 2 18219816 missense possibly damaging 0.75
R4758:Dnajc1 UTSW 2 18308946 nonsense probably null
R5790:Dnajc1 UTSW 2 18307087 intron probably benign
R5950:Dnajc1 UTSW 2 18306941 intron probably benign
R6049:Dnajc1 UTSW 2 18231700 splice site probably null
R6770:Dnajc1 UTSW 2 18217271 unclassified probably benign
R7242:Dnajc1 UTSW 2 18293972 missense probably benign 0.06
R7462:Dnajc1 UTSW 2 18308899 missense probably damaging 0.99
R7716:Dnajc1 UTSW 2 18219873 missense probably benign 0.00
R7846:Dnajc1 UTSW 2 18219893 missense possibly damaging 0.56
Z1176:Dnajc1 UTSW 2 18293987 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGACTCTGGATTTGATCTCCATG -3'
(R):5'- GCAGTGGTCAGTGAGCAATATTG -3'

Sequencing Primer
(F):5'- GGATTTGATCTCCATGCAGCTC -3'
(R):5'- CTTCAAAGATGGAGTCTACGA -3'
Posted On2016-12-15